S03036-01_H03
Seqid S03036-01_H03
Sequence >S03036-01_H03.phd
CGNNNNTTNNNNNNNNNGGNNNNNNNNNNGGGCGATTGGCGGCCAATCGGCCGAATTGGT
AGTTATCCAAGACAAAAAACCAGCAGCTAACATTGCTACACATAACTAAAGAACAACACC
AAGCCAGTAACTAGCACGAAAGGAAGGAAAGTAAAGTTTTGTATCCCATTCTCTTTTTTG
ATTCTTATTGAAATGTTAGGATTATATCTATCCTCCCTTTTCTTCGCCTTTTTTATGGCA
CAAGTGTTTGCTACCAAATACTCAATTACTTTTACATCAGATGAGTATGAAGAAGATGAA
ACAGGACAAAATGAACCTGGTCCTTTAGTTTTCCATTTGGATAAAAACTCATTACCACCA
GCTCTGCTAAATCAAATGGAGTTTAATCCATACTTAGTATTAGCAGATTTACCGGAGGAG
CCGCGAGCTGTTGATTCTCAAGAACATACCGATACGGTCCTTGCTTCCAAATCTGTTATA
GAATTTCTGTTGGGANGATGCTCTAACAATAGTGGAGCACAAAAAGTTTTCTCAATTTGA
AAGTAATCTACATGGAATTATGGGAGATAGCNACAGAGAAAAGTTGGGAGNAAAAAAAGT
ATNTGAAAACACTCCCCCACCCGAAGATTTGGGGGGTAGGNAGAGATTTANNACTTATTT
GAGCNTTTANGGAGGAACGTTTCCATAAATAAATAAAGAAAAAAAATNTAANTTATTGCA
GGGATTNAAGAGGNGGAAATGGTACATAGATATTTTTGTGAAATATTTAAACANAGGGGG
AAAGAAAATGCGGAGCTTCTNNAATTGAAAAAAAAAAAAAAAAAAAAAATTANTAAATAN
TNGGGGGCGGGGGGGGGGAGAAGGGNTATATAATACNAACT
Quality >S03036-01_H03.phd
8 8 6 5 4 5 11 9 3 3 3 3 5 5 5 6 5
9 9 7 5 7 5 5 6 5 3 3 5 8 17 22 12 22
25 16 31 34 15 17 21 25 17 11 8 9 34 30 28 25 34
35 29 22 13 24 31 31 21 25 25 26 29 20 35 30 34 21
14 24 18 21 18 38 28 42 37 37 28 24 28 26 36 31 34
30 46 36 30 34 34 30 42 42 52 35 30 29 43 17 50 30
46 30 35 35 31 26 31 21 28 30 20 26 17 26 35 35 31
33 27 33 35 33 32 32 42 44 39 42 44 44 44 39 36 39
42 42 44 49 50 44 46 44 50 42 50 44 47 50 50 60 60
49 47 49 60 60 49 60 49 44 60 49 60 60 43 42 57 57
57 57 57 57 60 60 60 60 60 60 52 46 60 60 60 57 60
52 60 57 52 58 47 40 48 35 58 52 60 63 52 29 60 60
47 52 57 57 52 52 52 57 57 41 57 48 43 35 57 57 60
60 35 57 57 26 60 52 42 57 48 60 57 40 39 34 60 60
19 47 27 24 19 23 30 47 26 57 48 43 39 52 41 53 57
45 57 53 45 36 53 60 45 42 52 45 48 28 52 53 63 53
53 42 60 23 60 46 41 46 52 24 52 52 35 46 46 37 57
52 52 42 52 52 44 52 19 52 46 52 60 40 22 57 63 32
31 35 52 60 60 42 47 46 53 42 52 42 60 63 23 37 63
37 60 57 35 31 47 60 57 57 44 60 28 39 60 57 46 53
42 25 46 60 60 48 43 40 28 42 24 60 60 35 60 58 24
60 57 35 60 47 57 47 47 57 31 42 34 52 60 47 42 31
52 57 44 52 43 40 47 47 63 60 42 52 42 34 57 34 47
30 42 47 63 34 34 52 35 35 51 35 27 44 35 31 44 23
60 49 35 42 63 42 63 33 9 58 42 16 42 40 23 35 27
47 42 33 39 42 24 50 44 39 21 58 31 28 31 27 30 39
42 34 31 18 35 25 44 44 36 39 35 35 39 16 42 29 31
46 22 49 22 17 19 54 16 43 11 33 39 29 27 22 42 14
35 41 22 30 23 30 9 38 42 42 18 20 20 9 15 39 24
10 9 7 13 16 11 8 11 12 15 15 10 19 12 10 30 27
17 16 11 27 50 31 11 46 21 19 24 22 21 27 27 18 31
49 37 37 16 20 13 26 27 9 32 18 30 30 30 27 21 30
28 9 32 25 18 18 23 31 30 14 10 18 26 14 19 10 18
30 22 14 18 13 20 16 21 19 10 7 9 12 15 28 10 8
10 21 23 21 14 12 9 12 11 11 11 8 6 15 22 32 17
10 27 12 14 13 16 12 7 9 9 16 14 10 11 10 17 14
14 17 19 18 14 10 11 14 16 35 12 11 10 10 18 14 15
14 9 14 25 30 13 15 9 10 13 10 7 8 14 16 8 12
21 32 24 9 7 6 18 21 27 22 12 30 23 21 11 10 15
10 6 22 20 15 18 6 30 21 14 38 11 8 11 11 16 13
14 11 12 10 10 27 29 21 17 11 10 9 12 11 19 19 21
11 15 25 25 28 14 23 24 9 9 6 10 9 11 6 11 11
11 9 9 11 12 9 9 13 17 9 9 10 7 9 8 11 8
15 10 6 17 11 9 11 9 8 12 11 11 22 15 11 25 15
10 16 10 9 19 11 19 14 11 11 11 15 14 14 22 11 16
14 10 13 16 12 24 12 33 7 12 18 13 14 13 16 14 13
11 10 11 9 10 18 14 24 13 16 24 18 10 11 15 19 11
9 6 6 13 11 11 8 10 14 9 11 11 46 32 25 27 34
14 18 40 11 27 14 32 27 14 22 19 11 13 11 9 9 7
9 9 11 11 9 11 6 11 6 9 12 19 9 9 11 13 14
14 25 15 15 32 15 23 11 11 12 11 9 10 14 9 7 11
14 13 12 25 11 11 9 11 11 6 9 11 11 12