S03036-01_H04
Seqid S03036-01_H04
Sequence >S03036-01_H04.phd
NNNNNNNNNNNTTNTTCGGCANNNANNNNNGGCGATTGGCGGCCAAATCGGCCGAATTGC
CGGAAATTGTAGGAATAAAAACCTGTTGGAGTAAAAATCAACCATCATCTATCAACTAGT
AGTTACACTATCAATATATTATCATATACGGTGTTAAATGGTGACGCAAGTTATGAGAAG
CTGTCATTGAAGTTGGAGGAAGCTGAAATGCAAGGATTGATAATGTAATAGGATAATGAA
ACATATAAAACGGAATAAGGAATAAAACGGAATGAGGAATAATCTTAATATTAGTATGTA
GAAATACAGATTCCATTTTGAGGATTCCTAAATCCTCGAGGAAAACTTCTAGTATATATA
CTGTATACATAATATTATAGCCTTTATCAACAATGGAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAGTACCGGCCATAAGGGCCAGCTTGAGTATTCTATAGTGTCACCTAAATA
GCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTC
CACACAACATACGAGCCGGGAGCATAAAGTGTAAAGCCTGGGGGTGCCTAATGAGTGAGC
TAACTCACATTAATTGCCTTGCGCTGAATGGGCGGGTTGCAGTCGGGAAAACTGTCTTGT
CANCTGCANTAANGAATCGGCCAACGCGCGGGGAGAGTCTGTTTTGCGTTTTGGAGGNTC
TAAAAGATAAAGGGNAGAGGGATNNGCTNTNTCTATATATATAANAAGGANNACANGAGA
NANAGGNNNACTCNCGNNGGNNNTGTAGNCAAAAAGAGAGAAAAAGAACACAGATCNNCN
NCCNCNNNNNAGANGNNNGGGGGGGGNNAGGTNNTTNTTATA
Quality >S03036-01_H04.phd
5 5 4 4 5 4 5 2 3 4 5 8 17 6 10 8 9
10 10 8 10 5 5 7 9 5 5 3 3 3 13 20 12 20
27 15 34 37 19 17 33 20 17 21 15 16 29 40 36 31 24
35 45 41 32 18 30 50 41 31 35 34 40 9 9 21 18 44
44 37 30 32 46 44 41 26 49 51 49 51 49 43 49 52 52
46 46 47 42 54 38 38 49 49 49 43 42 42 40 35 42 43
42 42 59 43 50 54 49 44 46 42 38 39 35 44 44 42 43
44 54 42 54 44 50 60 50 50 45 50 60 44 47 47 49 60
60 60 58 45 52 54 44 47 54 59 59 59 54 47 54 50 58
60 52 54 51 60 58 63 52 50 60 45 44 50 60 60 60 51
54 50 59 52 60 58 50 51 49 60 50 50 60 49 49 54 54
50 49 50 54 60 60 60 43 41 63 47 63 63 60 43 45 57
58 63 63 46 44 58 57 60 57 57 43 37 52 47 57 52 57
60 57 52 52 57 57 57 57 57 57 57 45 46 60 60 52 57
57 40 40 60 60 57 57 60 57 60 60 57 57 60 60 63 47
57 60 59 52 57 52 52 52 43 41 47 43 44 60 60 63 52
44 43 41 41 63 63 57 47 57 41 35 63 60 58 60 63 57
57 52 52 52 57 59 57 52 58 60 52 57 57 43 41 43 57
57 52 60 52 46 57 57 57 47 52 63 63 43 60 50 49 63
44 32 58 60 52 47 54 63 54 60 60 49 47 60 35 50 47
45 42 33 20 21 35 47 43 47 47 43 34 43 41 43 47 49
60 60 60 50 60 49 35 43 60 47 60 47 50 47 43 38 47
47 50 54 54 49 43 43 43 43 63 63 54 49 44 43 44 44
47 47 60 54 60 44 47 47 60 42 47 47 60 49 49 60 58
63 63 63 57 57 57 54 50 49 49 49 54 59 54 49 46 46
46 54 54 54 39 27 39 42 39 35 44 38 44 42 50 39 38
35 54 34 49 46 44 46 35 39 42 46 44 46 42 36 39 42
22 39 39 28 42 22 50 22 35 42 16 23 21 28 43 28 42
42 42 39 39 35 39 42 32 46 36 42 36 39 42 47 24 33
28 31 42 50 20 30 33 27 37 27 24 31 42 13 37 46 46
49 42 54 30 37 46 34 59 54 33 28 39 15 35 50 20 35
27 50 22 27 26 29 24 32 21 42 19 24 19 22 16 19 33
18 35 42 18 21 15 11 12 15 41 22 19 22 17 11 8 10
18 30 13 30 26 32 32 24 31 18 21 14 37 35 26 30 35
28 24 35 35 37 29 18 27 16 30 16 29 46 11 10 18 8
22 15 28 14 18 18 33 32 17 25 27 20 30 17 16 16 10
10 17 21 23 25 14 21 27 18 14 14 13 16 14 12 9 16
30 10 11 10 28 14 8 21 17 12 17 11 18 19 17 14 28
22 27 41 17 11 12 21 15 25 10 9 36 10 10 16 13 7
11 18 14 11 9 7 18 12 12 6 13 31 22 14 11 10 15
16 17 22 18 17 16 20 20 21 29 40 30 32 17 13 30 15
10 12 8 14 16 19 30 25 14 14 10 35 21 28 20 28 16
11 16 10 6 11 8 8 12 8 11 19 8 16 14 8 12 16
13 19 13 7 8 8 11 11 19 13 17 21 7 7 10 8 28
7 11 7 32 12 16 26 10 11 11 11 20 15 19 20 15 7
16 16 13 13 13 7 6 15 10 25 7 8 8 8 16 7 11
7 14 12 9 6 6 7 16 8 8 9 6 10 10 6 5 9
9 7 6 6 18 11 10 8 12 6 10 15 15 28 16 16 13
31 10 22 11 28 11 26 12 8 11 9 9 9 15 9 12 10
13 9 15 6 7 9 7 7 11 14 7 13 7 7 7 7 7
10 12 16 7 9 6 5 6 21 13 30 10 19 18 19 8 7
7 8 11 15 10 6 6 9 9 6 12 13 11 20 15