S03036-01_H07
Seqid S03036-01_H07
Sequence >S03036-01_H07.phd
NNNNNNNNNNTTCGGGNNNNCACATGGGNGATTGGCGGCCAAATCGGCCGAATTGACCAG
TCCATACAAACTTGAACCGTCTGCGTACCAGTCCTGATCAAAATGTTCCCTATCGCTTCC
AGAAGAATACTCCTCAATGCTTCAGTTCTGCCATTGAGACTGTGCAATAGAAATTTCACT
ACCACAAGAATATCCTACAACGTCATACAAGATTTGTATTTGAGGGAACTAAAAGACACC
AAACTGGCTCCAAGTACCTTGCAAGATGCTGAAGGTAATGTTAAGCCTTGGAACCCACCA
CAAAAACCAAATCTACCAGAATTGGAACTTCAAGGCCCAGAGGCTTTAAAGGCTTACACC
GAGCAAAATGTAGAAACTGCTCATGTTGCTAAAGAGACTGAAGAGGGTGAGTCAGAGCCA
ATTGAAGAGGATTGGCTAGTTTTGGATGATGCCGAGGAAACCAAAGAAAGTCATTGAACT
TTTCATAGCATTTTCCTTGTCGANNAAAAAACAAACAGAACCACAAGCTGAACAAGATCA
TTATTTTTGGCTTTCTTCCTCTCNTCTTTTTATATTCGAATCCAGTACAATAAAAAAAAN
GCAAAATACACTACNCACGCTGTGGAATCAGCGGCANAAAATGNAACNTTTTAATNCTGT
GCNAAAGAAGAANATGNGNNTAGAACACATCTTGNTCTNTCAATTTCAGTCAANACTAAG
AATGAATAACCATTTNNTTTTTTGTCCGGCNCGTGGGGGGGGGGANGGGGGAGANAGTGT
AAAACNAGTANGNTAGAAAAAAAGAAAGGANTCCNGGANNTGTAGGNCTNCGTTATATGA
CTGGAAATAACTTTAAAAGCAGGNAGACANCCGCCAGTANGGNAGANAGGGGGNANAANT
NNGNTGGGTAAGAGCAAGNNTGAAAAAAAAATGAANGNNAGN
Quality >S03036-01_H07.phd
4 3 2 4 5 4 6 5 6 5 9 12 12 12 8 8 5
3 5 5 8 9 8 9 9 9 14 22 7 27 30 16 33 42
21 16 40 24 13 19 10 8 15 31 38 38 29 41 42 34 31
18 32 35 30 20 23 20 20 30 35 41 26 27 36 41 36 30
42 35 37 35 35 42 30 49 43 50 46 49 43 39 32 43 39
44 39 42 44 38 47 50 60 60 42 47 34 44 44 35 44 42
42 42 52 42 35 47 39 35 39 44 47 42 46 47 57 52 60
46 42 46 52 57 46 52 46 52 57 52 60 60 57 57 52 60
52 60 63 57 60 52 52 52 52 57 58 54 60 52 52 52 52
57 57 57 54 54 52 52 57 58 57 60 52 60 47 57 57 52
53 60 52 57 63 60 54 59 52 52 52 57 52 52 59 57 60
52 57 57 59 63 63 63 63 58 63 63 58 60 63 58 57 58
57 63 63 63 57 57 57 57 52 60 57 57 57 60 52 60 60
60 54 52 60 52 57 52 52 52 52 52 47 60 46 40 29 29
20 32 29 42 40 47 57 52 52 57 54 60 53 52 60 57 57
57 52 60 57 52 58 52 60 57 52 52 52 63 63 60 60 57
57 54 63 60 63 63 52 63 57 54 57 63 63 57 63 63 63
63 57 57 57 58 60 57 60 57 63 57 58 57 57 58 60 57
57 52 54 57 57 57 57 58 60 54 57 52 63 63 52 52 60
58 54 63 58 54 58 60 52 60 57 57 58 46 60 57 52 60
52 52 57 57 60 60 52 60 57 60 57 52 52 57 57 57 57
57 54 60 57 52 52 52 60 40 60 52 54 57 60 52 47 52
52 57 57 60 60 57 57 57 60 57 60 60 60 57 57 52 42
57 60 60 57 57 52 52 57 57 60 57 52 63 57 57 57 57
60 52 46 57 52 60 57 63 39 57 46 36 47 52 60 57 52
58 60 52 47 57 52 28 57 43 41 35 45 40 52 60 52 52
57 57 52 35 42 57 52 42 52 27 41 41 57 34 36 41 40
20 24 18 23 29 32 28 35 22 14 14 21 35 34 47 33 15
29 36 46 39 40 32 42 47 35 42 46 42 28 39 39 40 18
20 25 28 39 42 40 22 18 18 41 7 5 8 33 32 20 27
32 33 23 17 32 29 16 9 18 21 22 20 21 46 44 32 24
22 26 35 36 30 28 18 22 22 30 13 46 46 39 39 35 28
28 28 16 29 32 19 15 25 47 28 15 9 19 27 27 28 23
22 9 7 12 13 9 10 10 30 31 21 40 20 38 35 21 9
47 42 27 28 25 15 14 19 32 19 35 19 15 19 18 18 11
30 32 11 9 6 11 11 9 20 32 19 25 20 31 9 9 10
16 14 6 16 10 10 13 12 12 13 10 37 14 11 10 11 21
11 18 10 11 9 11 8 7 11 15 13 41 39 14 6 8 11
11 7 9 13 35 17 10 10 8 6 9 13 10 8 10 9 6
9 24 13 10 11 8 9 9 12 7 10 24 33 6 10 6 6
9 9 15 10 18 22 14 9 10 10 13 11 18 11 7 12 11
9 7 28 13 12 11 9 20 9 9 14 8 11 11 9 14 6
13 10 10 14 15 11 13 14 9 11 17 24 11 16 18 19 14
13 9 8 9 7 6 9 12 10 8 11 10 10 9 9 9 11
10 10 6 9 12 10 30 12 19 17 9 10 19 17 12 15 10
6 11 10 8 10 10 8 12 9 6 9 15 15 15 11 12 12
13 14 9 7 11 12 8 10 7 11 7 10 10 8 18 46 17
32 16 32 27 16 19 14 14 10 9 9 7 10 9 11 6 10
9 10 6 6 9 14 11 12 25 11 6 9 9 7 11 11 20
13 10 8 9 8 9 13 8 10 8 9 9 10 9 9 14 9
10 10 10 9 9 13 12 9 12 9 10 10 9 6 10 11 9
9 24 7 13 11 8 9 10 9 9 10 9 6 8 9 6 9
8 11 6 9 10 14 14 14 12 6 9 6 9 9 6 10 6
6 11 6 18 14 11 10 11 9 9 11 11 14 11 11 13 13
6 6 8 11 18 16 9 14 19 12 12 40 9 10 13 10 9
6 9 6 6 19 9 6