S03036-01_H08
Seqid S03036-01_H08
Sequence >S03036-01_H08.phd
TTNTNNTNNTTCANGNNNCNANNNTATAGGGCGATTGGCGGCCAAATCGGCCGAATTCCC
ATGGGGATCCGATATCAAGCTTGGGCCCGGTACTTTTTTTTTTTTTTTTTTTTTTTTTTT
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTATTACAACGGCCATAAGGGCCA
GCTTGAGTATTCTATAGTGTCACCTAAATAGCTTGGCGTAATCATGGTCATAGCTGTTTC
CTGGGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCCTAAAGT
GTNAAGNCTGGGGTGCCTAATGAGTGAGCTAACTCANATTNATTGCGTTGCGCNCANTGG
NNGNNTNCCAGGCNNGANNNCTGTTNTGCCANCTNANTAATGAANAAANAATTGNNNGNA
AANAGGTTNGNAGATTAGTGAANACNNTTANCNNNNTNAGTCAAGGNNNNNGGNNGGCNN
NNGGNAGAANNANNTNTNANANNNNNNCATNNGANAANCCATGNNTGNTGNATNAGTGNT
ANAGGANTTNNTGATTTGGGGATAGGGATGGTGNTGGAGTNTNNTNGTAGGGTGNTNCGN
GNATGGGGGGNCTCANNCTGAACTNNNNAAANNTNGANAAACGAGGCTGCTGTCNGNAGG
TAGGTACTGTNGTTNTNTATGTACAACGATCNNGNGTAGANNTTCGNCAACCNNCANNGN
TAAGTAATGANTNNGCNCATTCTTTAATTNNTNNANGTAGCNNNCTNNANTTGTCTGANA
TTCGNGAGCTNAAGCTAACCATATTCAAGTATNAGTAT
Quality >S03036-01_H08.phd
24 19 5 10 5 3 9 6 5 9 15 8 8 7 10 5 5
3 8 5 8 5 6 4 8 8 8 9 9 16 19 10 30 23
26 30 41 13 22 37 19 20 29 9 12 26 50 52 46 30 46
54 46 39 16 35 52 46 37 28 21 49 50 49 50 52 16 16
52 50 46 42 50 37 42 33 30 42 50 51 51 51 50 46 23
43 50 35 49 49 42 27 42 28 36 27 27 30 32 36 38 32
32 30 32 32 32 30 30 30 32 36 38 42 50 41 41 41 41
40 34 34 34 38 36 36 37 45 45 42 22 25 21 40 42 38
37 36 36 35 35 33 33 33 33 40 40 40 40 35 35 35 21
28 40 36 31 26 21 12 9 16 10 8 14 27 19 19 20 19
18 24 10 16 19 24 18 19 16 8 10 20 21 23 15 9 14
21 14 24 26 17 11 13 29 30 26 18 10 10 21 14 36 29
16 23 41 40 20 36 27 24 30 32 40 29 21 19 23 17 26
27 31 13 21 41 40 13 16 29 24 30 9 12 14 26 12 10
10 14 14 18 34 12 24 10 26 46 47 40 23 19 14 15 41
12 21 18 21 16 43 30 30 13 30 13 23 31 37 27 42 11
30 21 16 30 25 21 14 22 22 23 31 32 15 14 23 30 36
25 23 12 24 12 27 10 44 31 31 18 27 17 7 14 14 8
7 22 13 24 26 28 40 13 28 16 30 9 9 9 10 14 15
13 18 31 20 15 31 16 19 13 23 12 19 9 7 9 12 20
7 8 14 20 11 13 9 16 8 8 12 8 8 7 8 9 6
9 20 9 7 5 9 5 7 8 7 9 10 13 9 8 9 7
7 13 10 6 5 5 8 12 11 9 9 7 17 11 9 8 9
6 17 13 5 8 6 12 13 18 10 15 22 8 7 8 11 11
7 9 17 10 9 10 5 5 6 10 6 11 11 11 6 8 11
27 23 15 7 10 6 8 8 8 8 9 8 10 14 8 8 11
5 14 8 5 5 14 12 8 5 8 5 5 5 5 9 5 9
9 9 9 10 9 10 9 5 5 5 5 6 10 15 5 5 8
10 11 5 6 7 7 14 8 5 10 8 8 8 5 6 10 5
5 13 6 10 6 11 7 14 6 5 6 5 5 6 15 9 14
5 7 9 10 5 14 14 7 8 9 9 10 11 5 5 10 10
7 8 14 5 14 14 5 11 10 14 14 6 9 10 5 14 11
10 11 7 9 11 5 5 11 9 11 9 11 10 8 9 11 14
8 9 8 14 14 12 11 10 11 14 10 10 7 11 11 10 11
8 14 7 8 6 5 8 5 10 8 9 10 11 9 10 9 6
11 7 10 14 7 11 7 10 14 10 8 14 12 8 11 5 10
14 11 14 7 5 8 11 10 11 14 11 10 7 7 5 7 9
11 10 6 5 14 7 11 11 5 9 11 9 10 9 9 11 11
11 10 10 9 14 8 10 11 6 14 7 11 9 14 8 10 10
9 14 11 9 14 9 9 6 11 9 10 6 8 6 10 15 9
10 9 9 11 10 9 9 9 9 10 11 6 6 10 6 8 8
14 8 8 7 6 14 18 11 11 6 14 14 9 8 9 7 6
10 10 6 6 8 7 14 9 9 15 14 9 8 9 11 9 6
9 6 7 10 11 6 9 14 9 9 8 10 8 11 11 9 11
9 6 6 9 6 6 9 6 9 10 14 9 8 6 7 6 9
10 6 6 8 6 10 9 14 11 11 8 14 11 6 9 10 10
11 14 7 10 10 9 9 14 6 11 10 11 9 9 8 9 10
9 9 9 9 11 11 11 10 9 8 8 9 9 6 14 10 10
14 13