S03036-01_H12
Seqid S03036-01_H12
Sequence >S03036-01_H12.phd
ATTTTNNTNNNNTNAGGNNCNAANNNANANNGNNANTGGCGGCCAAATCGGCCGAATTGA
TCGGTTGTTGTTTTTCGCCAGTATAATACAATTGATTATACATTTTGAACTAAACAGCAC
AGCACAATACAACAATGGATTCTGCCAAGATCATTAACATTATATTATCCCTTTTCTTAC
CACCAGTCGCCGTTTTTCTAGCCCGTGGGTGGGGTACTGACTGTATAGTGGATATCATTT
TGACCATTTTGGCTTGGTTCCCAGGTATGCTATATGCCTTGTACATTGTCCTACAAGATT
AAGCTCATTCAATAAACGAAAGTAACTATCAAATGAAATAAGGAAGCAGTATTAGGAAAC
GGTATCAACATGTTCGGGTCACCCTCATTTTTCTTTGTTTCCTTTCTTTTTTTTTGTTTC
TCTTTCTCTTAAGGTTTCCTCCCCCGCTGTTAATTTTAACAAAGGGTGTCCACCTAAATA
TTAATTTNNTAAAAGAAAAAANNGANACATTAAAGAATAATTCANAACCAAAAAAAAAAA
AAAAGAGAAAGGAAGGANAGGCATNAGTGCNTGTAAAAAATTATAAAAACCCCCCCTTAC
CNCTCTGNNGGGGGGNGNGGGGGNAGGGGGTGGTTTANANATTATTTTTNANTTGAAAGA
AACCAAAAAAACCAACNACGTNNGGGGTGACTNATATNAGANNAAGAGGANATGCGGAAA
AAAATNNAANACACACGACCAAAAGATAGANGANGGAGAAAANGGGTATNNTTANTTTTC
CAAAATAAATTAAAGNAANAAANTTATGACNANATATATAATANTNTAGGAAAAATCGCN
NAGTACNCNCNGNNNNNNNNNACGNAGNANTGNGGAGGGGGAANNNTAGTTGTACATACG
NNACAACNTNTN
Quality >S03036-01_H12.phd
8 10 15 16 8 6 5 10 6 6 3 3 9 7 9 12 12
7 5 9 5 8 8 7 7 7 8 6 10 6 5 10 6 7
8 5 15 27 18 17 20 20 12 16 13 13 13 29 30 26 23
31 31 32 38 12 26 28 18 10 13 17 17 20 21 30 36 32
30 32 35 49 35 35 35 33 29 33 38 27 41 28 42 42 31
29 35 35 33 36 42 42 43 46 44 44 42 39 39 31 42 16
47 38 29 27 40 34 36 32 25 19 22 31 44 31 42 47 47
47 52 46 52 47 47 47 48 48 60 57 52 47 52 47 52 60
53 48 48 52 57 58 57 53 48 52 52 60 52 63 52 57 57
58 63 63 63 63 58 63 63 58 63 63 63 53 57 57 60 57
58 63 63 63 53 63 63 52 60 52 52 52 63 63 58 52 57
57 60 57 63 58 57 58 60 60 52 52 52 52 60 60 63 63
58 52 63 60 58 52 53 57 60 52 60 42 48 60 57 53 53
57 58 54 57 57 57 57 57 63 57 52 52 52 48 40 40 35
48 40 40 60 52 52 52 57 57 60 63 63 63 63 63 63 52
58 52 52 52 57 60 52 52 52 63 63 57 53 63 63 53 60
60 57 57 57 52 57 57 52 57 52 57 60 60 53 58 63 57
57 60 53 57 57 57 60 52 63 52 57 57 57 60 63 57 57
57 52 57 52 57 52 57 57 60 57 52 57 58 60 63 60 60
57 57 52 60 60 57 58 57 48 52 52 57 52 53 57 60 52
60 57 52 48 48 40 48 60 37 41 52 52 52 57 35 43 43
43 48 43 43 35 30 28 32 32 35 44 47 44 45 57 57 43
48 48 48 52 52 52 60 46 52 43 43 52 53 57 60 53 53
44 43 60 44 44 44 44 43 43 43 53 53 60 43 43 47 45
39 34 29 35 53 37 42 33 16 24 24 25 11 13 13 28 42
16 18 24 18 42 37 40 35 42 33 35 15 27 18 18 18 19
25 28 41 39 53 53 45 45 22 25 25 23 34 16 23 44 37
9 9 21 9 10 8 17 10 23 11 11 11 8 9 13 13 10
9 8 10 14 14 19 15 14 17 16 11 6 6 16 11 12 11
10 8 14 10 9 10 9 11 6 6 11 10 6 14 15 13 12
14 28 15 21 19 12 10 11 13 9 11 11 11 9 7 12 28
8 9 13 37 13 28 41 25 16 14 19 16 9 18 14 32 18
8 15 14 10 10 15 14 11 23 10 17 12 10 7 8 10 9
12 18 19 6 14 9 13 9 9 6 9 11 10 12 10 12 28
17 12 10 11 11 16 10 11 15 19 9 10 11 18 11 11 11
9 9 9 9 10 10 6 11 11 9 10 10 7 6 9 9 12
15 14 12 6 10 6 14 14 11 12 19 6 9 14 10 11 11
9 9 14 9 9 10 9 9 7 9 6 9 9 11 9 12 19
15 9 10 7 9 7 10 9 11 11 11 16 9 11 11 13 11
10 11 18 16 12 24 15 16 14 10 9 11 12 7 9 9 9
10 7 6 9 10 10 10 9 15 15 10 10 6 14 9 10 9
6 11 16 11 6 6 11 9 9 19 9 9 9 6 9 9 8
11 11 9 14 33 24 11 15 14 9 10 6 6 8 10 6 11
9 14 9 9 9 9 13 9 9 14 15 9 9 16 9 9 11
14 9 6 8 10 6 11 8 10 13 11 11 10 8 6 8 9
10 9 9 14 6 6 9 8 8 6 11 13 13 9 9 8 9
10 9 19 8 11 14 10 11 11 9 10 9 10 6 14 16 6
16 14 23 6 9 11 8 8 11 11 10 7 8 6 18 8 9
9 12 10 9 14 21 11 6 14 6 10 9 11 11 8 11 13
9 9 9 9 10 9 6 6 19 10 11 10 10 6 10 7 9
6 11 6 6 6 7 6 6 6 6 6 11 10 9 6 11 9
6 9 7 10 9 5 13 10 8 10 8 8 9 11 11 9 6
5 5 11 10 11 10 10 8 9 8 11 10 11 11 8 9 7
7 14 8 8 9 9 6 8 5 11 5