S03036-01_A19
Seqid S03036-01_A19
Sequence >S03036-01_A19.phd
NNNNNNNNNNNNNNNNGNNNNNNNNNNNANNGCGANTGGNGGCCNAATCGGCCGATTGCN
GGATAACAAACATCTTCTTTCGNNNNNNNNNNNNNNNACTACAAATTAAAAATGCAATTC
TCTACCNCCCNTTCNATCGCTGCTATTGCCGCTGTTGCCTCCGCCGCTTCTAACATTACC
ACTGCTACTGTCACAGAAGAATCTACCACTTTGGTCACTATCACTTCCTGTGAGGACCAC
GTTTGTTCTGAAACAGTTTCCCCAGCTTTGGTTTCCACTGCTACCGTCACCGTAAATGAC
GTTATCACTCAATACACCACCTGGTGTCCATTGCCAACCACTGAAGCACCAAAGAATACC
ACTTCTCCAGCTCCAACTGAAAAGCCAACCGAAAAGCCAACTGAAAAGCCAACTGAAAAG
CCAACCCAACAAGGTTCTAGCACTCAAACTGTTACCTCCTACACTGGTGCCGCTGTTAAG
GCTTTGCCAGCTGCCGGTGCTTTGTTGGCTGGTGCTGCCGCTTTATTGTTGTAATTTACT
CAACCTTTTCTTTAATATATTTTTAGAAAAATGGTTAAAGTACTTTTCCGTCAATACAGC
TTTCCACAAAATCCTTTTATTTCAATTAATAAGATATTCTGGTAATTTCTTATTCTAAAT
TCTAGGAAGCAACACTCCATAACTAAAATGGTTATTATAATAAATTTTTAATATAAAGGT
AACCTCNCTAAGGTCACACCCCGGCTAAGCATTTAGGATATTAAGTTGGTTGATTTTTAT
TTTTATCAAATAACTAAAAAAAGGATGCTGAAGGCTCCCTTCTTCCCCCCGTCCGCACAA
GAAGAAAAAAAGAAAAAAAAAAAACCCCCCCCCCCCCCCCCGGGGGGGAGGGGGGGGGGG
GGGGGGGGGNGGTTGGAAACTTCNCTCNCAAAA
Quality >S03036-01_A19.phd
4 2 3 3 3 4 4 2 3 2 2 3 2 3 4 7 8
6 3 2 3 3 7 6 3 5 6 5 11 5 6 8 8 16
19 6 12 21 8 7 24 33 11 22 6 12 8 31 30 35 31
23 24 32 34 17 37 15 8 7 9 31 14 12 14 14 29 12
13 31 24 28 42 47 46 42 40 42 47 41 35 35 5 5 3
3 5 3 3 6 5 6 6 3 5 3 5 11 35 29 21 41
14 35 40 45 49 24 38 45 47 49 34 42 34 24 44 49 52
36 30 29 38 37 16 19 6 20 10 10 5 8 9 9 5 9
12 14 23 49 50 46 49 42 28 43 53 49 49 53 40 51 29
31 53 51 49 35 42 30 49 53 32 49 51 35 49 49 49 38
35 32 53 42 30 49 45 46 49 51 33 50 43 50 49 45 50
44 44 51 44 49 36 43 39 28 42 46 22 21 10 17 18 16
49 42 49 42 47 47 43 41 22 33 44 49 39 42 52 47 60
57 47 52 60 43 41 42 52 57 40 58 41 28 63 34 22 48
57 52 52 57 43 43 60 48 53 43 48 63 52 63 63 60 57
57 57 63 63 57 63 63 53 60 57 57 52 53 53 48 53 42
60 48 40 48 30 48 52 52 57 52 52 57 63 60 57 52 47
48 63 57 52 57 63 53 48 60 52 52 57 57 53 60 57 52
42 52 57 52 52 58 57 60 57 47 57 57 47 60 53 52 58
57 52 57 57 60 60 42 57 63 60 46 63 46 63 57 60 44
52 52 54 52 57 60 60 44 52 57 47 43 43 48 48 60 46
57 52 57 60 52 60 63 40 40 47 57 44 57 57 52 44 52
35 57 42 57 52 52 63 63 57 35 52 52 30 57 47 57 39
52 57 57 57 23 42 57 34 52 46 60 47 44 47 63 47 42
44 49 35 49 42 60 42 42 35 47 60 39 39 49 35 42 24
19 20 31 47 47 28 49 44 50 39 60 42 44 44 35 35 39
42 54 39 39 54 50 36 50 54 36 49 42 38 46 50 44 54
36 44 35 35 42 44 44 54 19 39 27 42 36 46 42 42 42
54 44 59 19 42 26 42 50 54 42 34 42 35 22 39 50 43
44 42 39 42 33 35 50 44 50 40 46 39 50 37 49 43 44
35 50 42 50 42 44 44 42 59 29 42 42 43 42 17 12 22
34 21 33 27 12 25 43 13 39 26 28 30 25 18 11 21 27
35 21 30 30 32 38 22 41 33 19 23 23 32 27 27 26 32
28 49 41 24 28 30 37 35 35 35 35 41 35 19 36 30 26
13 13 23 35 30 22 26 29 33 28 30 17 23 30 14 17 25
23 16 9 10 30 23 30 16 32 25 17 44 21 31 37 33 25
22 31 31 34 30 29 31 20 30 19 12 14 29 24 44 16 29
18 18 39 16 43 21 38 18 42 35 44 26 44 21 17 38 31
42 44 17 34 31 31 29 44 19 15 19 17 19 32 32 16 15
11 11 44 24 14 23 13 20 25 19 18 25 32 17 32 20 39
24 19 17 17 26 35 30 35 23 14 11 10 14 11 10 10 33
15 19 52 12 29 23 29 13 10 17 14 14 15 14 16 42 33
31 33 36 20 15 11 10 15 11 18 11 18 6 14 20 22 20
24 19 16 15 17 17 16 30 19 24 11 11 10 14 17 9 12
8 15 13 28 20 24 14 11 10 9 11 10 8 10 12 11 11
11 17 24 18 22 14 12 11 12 32 23 12 18 20 32 50 46
20 11 9 11 10 21 14 25 14 15 12 10 14 11 22 27 17
23 26 10 10 18 14 15 18 11 11 19 32 32 15 14 11 9
24 14 10 9 11 11 15 26 23 22 19 10 11 9 10 11 17
10 10 8 10 11 18 17 11 14 10 10 11 14 16 15 28 14
16 9 18 20 26 16 11 32 26 15 14 14 10 13 14 15 15
16 20 16 15 23 20 15 46 28 28 34 32 18 17 19 16 11
9 11 9 9 10 14 13 14 32 34 19 32 22 28 22 32 32
25 14 16 16 19 15 11 14 7 10 14 14 9 9 11 10 12
11 9 10 10 8 7 11 9 10 6 9 14 10 15 10