S03036-01_H18
Seqid S03036-01_H18
Sequence >S03036-01_H18.phd
GNNNNNNNNNNNNTTNNGCNNNNNNNATANGGNGATTGGCGGCCAAATCGGCCGAATTGA
AGTATACTTGTCAACAAAATAAACTCATAGCAATTACACTATAAAAACAATAGCATCAAA
AATGTCACTAAGAAACATATCAATGATCACAAAAAATTTGCAAACAACTGCCAAGTGTTA
TGTCCCAAAAAGTTCACCTACATCAACAACTATTCCGGTTATAAGGGATGCTAGTACTAC
TCAATGTCGCAGAATAACTACCGTCATCAATATTACGAGTCTGAAAGGATATTCTCCATC
TCCAAGAACAGTTCATGATAAGCCAATTGTTATTTGCACTGACAACGAAGAGGTAGAGAC
CGTATCGGAGCACGTAAAAGTATAATTTGAATTAATCTACTCTTAACACTGTTCAAATGT
ACGTGTAACGTTTTGACGCTAAAAGATTCTAAAAAATTACTTTTTAAAGTTATACCCTCT
GACTTTATGTGACATCAGCATCCTAAGTACCTACCGTTCATAATTTGACGCTTTTCCTTA
TACATTCAAGCATCGATATATATGATTTTTATATATGTCCTCTATTCTAATACATACTTT
TTTACCTCTCGAAATCACCGAANAGTCGTGTGGGGGGGGGGGGNAATGTATATTTTTTAT
ATAAAAAAAGTACCGGGCCATAGGGGCCAGCTTGANTATTCTTTANTGGTNNCTAAATAA
NTAGNAAAAATNANGTCGATTTTNGTATATTATATNAANCCGGAAANNAAAAAGNNNNAA
GCCCGCGGNCGCCCTCTCTTTAGTNTANGTGAGNTAAATAGNTTNCACATACNACNCNCT
CTCCTCCCNCGCAACGGGGGGGGGGGGCGGCGNTGAGGAANNNAACCGC
Quality >S03036-01_H18.phd
12 6 5 3 2 2 2 3 3 3 4 4 5 20 8 7 7
8 9 6 7 5 5 5 3 3 13 9 12 6 14 10 6 17
32 16 20 32 18 15 30 24 15 14 12 13 26 38 31 31 37
41 40 37 32 16 41 35 30 19 21 17 38 21 25 35 29 37
49 49 43 28 34 42 32 33 50 46 46 37 49 35 35 40 35
33 21 32 31 32 35 35 35 35 42 35 42 22 28 25 32 32
33 33 39 42 35 54 35 42 34 36 35 32 29 36 44 30 36
42 39 37 44 52 42 34 39 42 42 50 49 44 45 49 49 60
54 60 51 46 45 50 49 60 49 58 50 50 54 59 52 57 60
50 60 49 50 60 63 58 50 50 58 58 58 50 60 51 58 49
60 37 47 60 45 63 63 60 50 50 58 46 49 50 60 47 54
59 60 60 60 54 57 51 50 54 50 54 57 60 49 49 60 50
49 63 50 50 58 58 50 50 63 49 60 49 49 63 60 50 50
60 54 60 50 57 49 45 31 50 47 50 49 47 47 50 47 50
54 50 47 42 40 38 38 60 49 49 50 60 49 44 63 42 40
49 60 49 50 54 54 47 60 50 54 47 49 42 42 49 50 60
47 58 60 50 47 63 44 58 49 46 63 57 63 47 42 63 33
31 47 44 63 60 49 60 47 39 49 49 50 60 47 24 58 60
63 43 42 42 49 49 43 44 42 49 51 50 42 60 43 44 44
42 38 43 43 63 45 43 44 60 39 60 54 50 42 42 44 54
60 50 35 31 54 42 32 49 60 27 50 25 50 36 46 42 49
42 47 36 54 50 50 50 43 46 46 51 54 26 49 43 35 49
54 54 54 50 54 50 49 49 43 49 53 54 57 54 50 50 54
43 54 39 49 49 46 50 49 46 50 50 43 50 42 51 50 39
42 50 54 54 51 44 39 57 53 42 54 39 50 44 54 50 54
31 49 50 39 54 42 46 49 54 44 50 39 44 54 44 22 46
49 54 59 50 19 53 39 42 36 53 49 49 49 51 42 57 54
50 42 46 42 42 43 39 54 54 50 33 50 43 27 27 27 25
33 31 42 42 42 50 33 30 54 43 42 50 54 35 39 39 15
18 17 17 18 27 19 20 20 17 23 26 35 38 54 33 42 44
43 42 54 31 38 54 31 54 31 30 37 31 54 35 49 49 35
44 44 33 54 34 50 49 50 44 50 37 43 49 16 54 31 35
30 37 33 21 54 30 33 26 32 35 23 27 17 41 32 35 35
46 36 43 47 14 54 54 54 46 25 37 23 28 22 30 42 27
19 35 32 35 31 34 26 38 32 38 42 46 22 31 11 18 26
30 28 21 28 28 28 25 19 16 19 11 11 8 11 8 10 14
14 17 11 10 10 21 9 13 18 16 7 9 18 9 8 28 8
21 8 16 15 10 18 18 13 12 10 15 16 10 11 7 10 9
13 10 17 15 14 8 12 17 14 18 14 11 8 12 10 14 17
12 13 9 16 18 13 33 14 18 12 22 11 12 25 18 20 19
22 13 9 23 46 31 16 21 13 17 31 20 26 20 22 6 10
9 14 22 15 19 11 10 10 7 9 17 13 11 6 6 13 17
21 35 26 11 26 16 7 10 10 10 7 8 16 10 22 16 8
7 12 7 11 10 10 11 12 16 18 10 9 6 15 11 11 12
11 14 13 16 22 13 21 5 15 10 7 13 11 14 14 29 26
27 6 6 16 28 16 37 16 12 6 6 6 6 13 8 12 11
16 13 9 15 17 10 7 8 11 20 14 10 10 8 23 18 14
26 14 19 10 11 6 9 14 6 26 24 11 13 16 6 11 22
14 31 15 9 11 5 10 16 7 10 9 13 14 13 14 12 7
11 14 6 14 7 15 10 11 12 17 21 8 16 12 25 7 17
13 8 11 12 11 14 26 21 27 36 38 31 32 35 19 30 13
11 10 27 14 11 6 12 10 9 10 17 8 11 1 1 1 23
14 14 13 12 11