S03036-01_H19
Seqid S03036-01_H19
Sequence >S03036-01_H19.phd
NNNNNNNNNNNNNTNTNNNGNAAAANNNANNNGGCGATTGGCGGCCANTCGGCCGAATTG
AAGCAACAAGAACATAAAAAATTGTTTTTGCTACATTGGTTTCACATAACATATTTCAAC
AAACATGCCATCAAATTTGAATATAGTGAAGGTTACAAAACCACAAGAAGAAAATAAGAA
TATTTTACACAAAAACACGAATGAACCCAATGAAATGGAACAATCGCAGACACAAGAAGC
AGTTACAGAAAATTTTACCGAAAACAGTAATCTCAGTGCAAATGAACATGCAGCTAGGAG
GGGTAGATTAAATTTGAAAACAGTTGATCACATAGAAACTTATCCAATAGTGCAAGAAAC
AGAAGAGATTGCAAAAAAGATTGCTCTAACGAGAATTATTTTAGCACAAACAAAGCCTAG
AATCGATAAAGTGGTAGTGTCACGTCCCGTTCAAGCCGTAGCACCAGTGGTCAATTTTTT
TGACAAGATGGCCAATTCGACTTTAAGTACAGTAGAGCGCGTTGTCCCTTCTTTGAAAAC
AAAAACTTATAAAAGATTAGGTGAGGAAATTGCACTTCCGTATACTTTGTCGAAAAAGAT
GGAACGCAGCTCAGGGAAAACGACAGCAAGAAATAGGAGAGAATTAGGTTTANAAACCGG
TCATGGAAGGTTGATGAAATTTAAGAGGTACTAAAATGAAAAAAGGGNGGAAACAAAAGG
TCAGCGTTTGATCACTGGCTAGGGGGGGNGGGGGGTGGGGAAANTTTTTACGAANTCCTA
CCACTCAGCGNTGAGGNNTGGGGGGAGGGANGAGGGGTACAANNNGGAGAAGTTTGGTGG
NAAAANAACCCTGGGAAAAAGAAGAACGGGGGGGNGAGAGAGGGAAGATGAGGGTTANNT
TTGTAATATAAAAACAAAAN
Quality >S03036-01_H19.phd
6 4 5 3 3 3 3 3 2 4 2 5 4 11 6 12 5
6 5 10 6 9 8 10 9 5 7 3 10 7 7 7 9 14
10 16 26 9 20 29 15 17 33 25 10 9 8 5 22 31 40
31 37 42 41 28 15 32 31 27 15 19 28 31 26 25 31 26
25 32 34 31 31 29 39 43 42 41 46 46 42 28 49 50 46
40 37 34 35 25 35 34 42 42 42 47 42 39 23 35 37 38
42 32 46 33 42 35 35 40 32 37 35 43 43 37 42 36 29
42 31 40 40 42 42 50 49 49 42 42 54 50 35 46 49 50
51 46 51 50 49 54 54 51 50 53 53 53 57 57 52 57 57
59 50 46 50 53 53 49 44 44 50 57 50 49 51 53 53 50
57 54 49 46 51 54 50 60 58 50 54 54 57 60 63 50 51
54 50 50 47 54 60 63 46 60 50 50 60 63 63 63 63 63
49 50 60 50 42 50 49 49 47 47 49 50 63 49 58 49 60
44 57 60 57 57 57 44 57 52 44 42 60 42 46 57 52 44
57 60 47 47 46 40 34 47 26 60 52 60 57 63 47 63 43
34 47 29 27 46 54 59 60 57 35 35 57 46 60 46 60 52
42 46 28 57 57 57 46 30 57 60 60 47 41 43 35 24 46
47 42 28 50 50 44 44 60 63 42 24 63 63 51 31 49 39
44 24 60 50 47 60 44 51 49 49 44 50 60 51 42 20 47
44 63 54 41 28 47 31 44 44 54 44 35 50 50 49 42 39
54 39 42 46 44 15 43 38 44 42 43 50 42 34 50 54 54
49 49 36 39 42 42 49 43 57 31 42 21 50 50 42 39 54
51 49 49 54 54 42 27 54 50 42 50 46 44 39 50 43 50
50 50 50 54 36 57 42 33 53 53 53 54 54 50 37 33 25
54 54 38 35 57 57 50 43 46 39 49 33 52 53 42 50 38
49 28 42 50 54 50 43 54 57 31 54 33 42 50 27 42 42
33 50 41 44 43 50 46 50 54 42 27 50 42 50 50 35 42
43 19 59 44 25 42 16 54 30 50 39 18 37 26 42 35 54
54 54 50 50 50 42 44 30 34 50 34 44 27 33 49 26 42
21 53 27 43 34 27 33 23 35 42 47 19 43 35 30 31 33
22 42 50 35 20 35 31 31 23 44 33 23 50 42 31 31 30
35 21 44 34 22 34 44 19 16 22 39 30 27 16 22 22 27
22 21 28 27 27 35 22 31 39 43 18 31 28 31 31 18 38
39 39 28 13 18 27 54 44 27 35 28 25 15 25 27 44 10
16 19 19 19 19 14 20 22 31 34 35 20 19 16 44 44 46
47 16 11 9 15 11 14 18 46 11 15 16 19 25 24 20 17
26 20 29 35 15 22 11 14 15 10 18 19 17 11 14 11 39
20 24 17 27 12 12 14 12 24 10 11 10 10 10 11 10 12
10 11 16 24 10 9 6 9 19 12 16 19 15 16 14 11 10
14 16 19 12 13 21 20 14 22 19 9 10 10 22 17 17 12
12 10 17 10 11 17 9 9 9 19 12 9 19 13 8 19 12
24 11 19 28 10 15 12 13 12 9 6 13 10 11 13 11 11
14 8 12 8 12 15 11 14 9 10 10 12 11 19 14 17 12
11 10 11 9 11 19 28 12 15 15 16 13 16 11 14 25 34
6 23 25 37 14 14 10 11 12 20 11 8 10 16 12 7 15
13 11 10 10 10 11 11 14 11 7 10 13 14 20 16 16 17
17 16 16 9 10 12 15 14 7 11 15 10 12 14 7 6 8
15 17 14 15 11 14 10 15 16 11 10 6 9 8 9 9 14
22 20 20 17 20 16 7 6 6 11 9 16 11 12 10 11 10
11 15 13 13 11 9 10 7 12 16 13 8 6 11 14 17 18
18 19 14 12 20 17 12 20 20 17 18 20 20 11 8 10 10
12 12 14 11 16 28 10 6 10 12 11 10 14 14 12 14 14
10 12 9 9 10 10 11 15 10 16 22 16 10 7 6 11 9
14 10 9 8 8 10 11 14 18 16 17 10 11 11 16 21 16
9 6