S03036-01_H20
Seqid S03036-01_H20
Sequence >S03036-01_H20.phd
NNNNNNNNNNNNTTTTNNGGGCNNANNNNNNNAGGCGANTGNGCGGCCANATCGGCCGAA
TTGAAGTAAAGTGCAAAGCATTTTGGAAGATATTATCAATTGAGTCATTGAAAGAAACTT
GGCATCTTCCCTATTACTAAAACTAAGAATACTTGATTCAAGAAAGAAGTTTATATTAGT
TTTAGCCGTAAGATAACATAACAAAGAAGAAGAAAGAAAAATGTCTCAAAAAAAGAAGGC
TTCCCATCCAGCCATCAATCTCATGGCTGGCGGCACAGCAGGTTTATTTGAAGCATTGTG
TTGTCATCCTTTAGATACAATTAAGGTGAGAATGCAAATATACAGACGGGTAGCTGGTAT
TGAACATGTTAAACCCCCAGGATTTATTAAAACTGGGCGTACCATTTATCAAAAAGAAGG
TTTCTTGGCTCTGTATAAAGGTCTAGGTGCTGTGGTCATCGGTATTATACCTAAGATGNN
AATCCGTTTCTCGTCTTATGAATTCTATAGAACCTTATTGGTTAACAAGGAAACAGGAAA
NGGTGTGTACCGGGNAATTGTTTTGTTGAGGGNGGGGGGGCTGGGAAAGGATAATGAATC
NTGACCTNAAAGGGNGGNGGAGGGNAAAGAGGGTATGTNTCTACCTTNTANAANTATTTA
ATAGANAANGCTNGTATCNATAGCGGCCCCAGGGNAGAAAGCGGGCTATAAAATTGGTAC
TGATCAACTGCAAGAGGGGGAGNAAGANNGGATGTTTGANTGTNGTTCTGATNAAANAAT
AAAAAGNAGGTNAAGGAATTCNATTNGCGCATCCNGNGGNNCAGGGGGGTAANTNTNCCC
NCTATNNNGANGNTGGCGGAGNANAAAANGGATAAGGNTTTNANGACTGNNGAATAAAAA
GAA
Quality >S03036-01_H20.phd
5 5 3 3 3 3 3 2 3 4 3 4 15 17 10 14 6
6 14 11 13 10 7 5 10 6 3 3 5 5 5 6 8 13
12 10 15 23 7 23 26 7 14 20 41 29 17 11 8 5 8
41 41 40 34 41 49 50 35 16 41 37 29 18 16 26 37 35
40 42 42 41 42 32 27 28 35 41 35 43 33 49 46 37 49
29 42 49 46 30 16 50 42 42 50 43 42 33 42 42 40 35
27 28 32 35 39 44 50 50 44 44 46 54 50 49 50 54 54
54 49 44 44 60 54 50 60 50 60 60 50 63 50 63 45 49
52 50 50 60 60 54 50 50 50 60 54 63 49 46 60 63 60
63 63 63 63 63 50 50 58 58 63 60 60 54 57 60 49 63
63 58 63 63 58 63 63 63 60 63 60 60 57 58 59 58 60
60 50 59 60 54 63 57 63 63 63 59 63 63 63 63 54 63
63 50 63 58 54 63 57 52 59 54 49 60 51 49 49 60 58
63 63 63 63 63 52 54 54 60 60 60 60 60 54 52 50 50
63 50 63 51 54 60 44 36 41 38 33 42 60 54 51 50 60
58 54 60 63 63 58 57 57 60 63 63 58 63 63 63 54 58
54 58 54 59 59 54 63 58 50 63 60 63 57 60 47 63 63
51 60 58 57 60 54 52 63 63 63 63 59 60 58 60 54 54
60 49 54 59 60 57 54 54 52 54 60 49 47 60 54 58 50
58 50 63 54 63 63 50 63 50 44 58 54 54 49 54 54 54
50 60 50 44 54 50 49 50 49 34 43 44 38 44 49 50 50
60 50 47 54 50 60 46 49 60 49 51 49 50 54 63 63 49
60 60 60 45 47 43 43 45 42 58 49 57 52 52 57 57 57
60 57 57 52 52 57 57 52 60 57 52 57 57 52 60 57 57
57 52 52 52 57 47 35 35 43 40 46 52 35 60 60 57 47
60 57 52 57 57 43 60 42 30 27 52 57 52 52 41 35 35
52 52 52 30 43 60 57 46 39 47 34 42 35 47 52 52 46
46 35 47 35 47 35 22 24 20 14 18 19 22 29 24 23 26
17 20 7 5 12 22 29 28 30 28 28 28 26 23 20 34 25
19 17 16 15 35 24 12 28 42 46 46 46 25 30 20 14 16
13 16 9 16 14 19 9 16 14 11 23 36 32 36 28 25 20
34 16 36 25 28 13 31 27 20 46 46 24 9 6 8 13 9
17 11 9 10 10 18 16 19 17 28 6 13 34 19 10 10 14
24 22 18 29 12 11 10 11 10 33 20 7 15 11 11 16 10
11 9 11 10 13 19 13 19 16 11 10 10 10 12 14 11 10
9 10 9 11 13 6 12 11 11 16 11 11 7 10 11 11 9
9 8 6 16 10 6 9 10 10 9 9 9 7 9 11 9 9
17 16 10 11 8 11 9 9 11 6 11 9 11 14 10 10 10
10 6 11 11 7 11 15 6 10 8 14 10 15 11 10 14 14
8 11 6 10 11 6 9 10 11 7 11 11 18 11 9 6 9
11 14 10 14 9 11 11 10 8 9 8 16 11 10 6 9 12
9 11 11 10 9 16 9 12 14 9 16 9 10 11 18 11 11
15 11 13 8 10 9 9 9 11 10 10 8 11 10 11 8 11
11 8 11 11 14 10 10 11 9 9 9 7 10 10 10 9 6
6 11 11 14 12 13 14 11 14 9 11 7 10 12 9 6 14
10 8 9 9 11 13 11 6 11 33 19 6 14 18 9 19 24
19 11 9 13 6 9 9 10 11 7 9 10 11 22 11 10 9
11 10 7 8 11 10 7 10 9 11 9 15 11 8 9 6 12
6 18 9 6 6 11 8 8 10 11 10 11 11 14 12 17 6
8 6 9 7 9 11 10 6 9 9 10 10 6 6 6 9 9
6 9 7 10 12 12 10 11 9 11 9 6 9 6 9 10 9
8 6 9 11 9 9 9 13 10 9 6 9 9 9 7 10 6
11 9 9 9 10 6 6 9 22 23 11 13 21 9 8 8 10
9 16