S03036-01_H21
Seqid S03036-01_H21
Sequence >S03036-01_H21.phd
NNNNNNNNNTGNNNNGNNNCNNNAANANANGGNGATTGGCGGCCAATCGGCCGAATTGAA
GTCCGTGCCATAAAATAATCACTAACAAATATAAGATCACGCTATACTATCAATGAAGAA
ACAAATATTAATAGTTGCTGCACAAAGTATTTTATGTTCTACTGTTTTTGGCGAGCGAAG
TAATGTAGGCCTTTCCACTGAAGAGCTAGGAGGTGACTCAATTTTATACTTCAATGAAGA
CCCTATAGTGATTGAAATCGATAAGAAAGCTATTGACAAGAAGACTCTGGAACAGTTGGC
AAGCACAAGAGACGTTGTTCTTACTGATTTACCGGACACTCTTGAGTTTATAGACTTCAA
TGAGTACGCGAAAATGAAGTCAAAATCAGATATGCTACTAGAGTATATCAACGAATACGA
ATTTGATGATTTTGAAAGAAGTTCTGAAGGCGGTCTTGATGAAGAAGAAGAAGAGGATTT
AATTTATGACTTCAATGCCCAAGCTGAAGATTTGGGTAAGCTTGGTTCANATATATATGA
AGTAGTCGAAGAAAANNATATTGTTAATACTTACNATGGAAACCTTATCAATGCAAGTAC
NACTGGAGNAACGACGACTATNCGGCGTTTCNTNNCTTCTTACTCTTAAGANNCNTGNTA
GAAGNNTACGGAATTTTTCGGCNTTGGAAGAGGGAAAGAANAAGAGGGCCNNTAAACCAT
CCACAAAAGGGAGAGAGGGGGAGGAGAGANNGGGAATTAANAAAATAAAAGATTNNGAAT
NATGTTTNCTTCCCCTTTGGATATATAGTGGGAAAAGAANAAANAAAATGACTTTNAANC
CCAANCATGGCCNNGGCGCGGNGGGGGGGGCGGAGGGCAAANN
Quality >S03036-01_H21.phd
4 3 3 5 5 5 6 6 5 8 8 5 7 5 5 8 5
6 6 16 6 5 7 9 9 5 19 6 12 6 26 16 7 21
19 15 18 29 18 14 27 22 14 13 11 16 31 31 30 24 34
36 35 26 12 30 32 26 15 16 20 30 31 28 37 33 50 30
28 18 32 35 37 46 40 33 35 36 30 31 29 42 26 21 17
26 10 12 18 32 34 36 23 20 21 25 25 31 17 32 27 32
31 26 30 21 28 20 16 26 20 18 21 28 32 30 24 26 35
31 28 37 30 32 35 35 43 47 31 35 30 35 27 32 35 49
50 42 43 42 46 30 43 30 32 35 37 43 52 42 49 46 43
54 50 49 54 57 53 42 49 50 52 54 35 43 43 49 49 49
39 42 49 49 54 50 59 43 36 31 42 46 49 43 52 52 49
49 51 49 49 49 49 50 51 50 43 43 50 52 50 53 45 43
35 34 42 49 47 46 42 31 43 33 46 26 30 35 43 22 28
35 40 34 29 43 43 37 50 35 34 25 28 26 35 46 36 35
33 28 29 26 21 30 46 50 46 49 46 42 23 26 46 40 35
35 43 49 36 28 17 37 28 35 35 42 43 46 46 49 49 35
35 49 49 42 43 31 43 49 52 49 43 43 28 52 49 49 45
53 41 45 49 35 49 46 49 49 50 30 35 43 49 46 36 46
28 35 46 43 32 42 27 49 49 51 35 46 49 49 43 49 35
36 46 49 42 31 53 43 35 46 51 35 40 30 33 25 45 35
40 28 29 29 29 33 29 32 32 30 32 35 43 35 43 35 40
31 22 29 46 49 35 37 33 37 43 42 42 52 47 51 46 40
36 49 43 43 46 52 41 35 37 39 39 46 37 30 35 50 35
36 47 49 49 42 46 43 50 46 37 51 35 43 49 33 52 35
50 35 49 49 35 49 49 46 43 42 28 50 45 35 47 28 29
32 27 43 31 26 53 43 34 30 35 46 39 35 39 23 30 35
47 41 46 49 41 31 22 46 35 37 49 22 41 29 20 29 31
27 29 29 14 17 14 14 17 17 15 12 14 13 17 20 20 19
21 17 37 35 20 34 26 32 22 19 26 40 28 30 28 29 14
15 26 31 37 11 20 20 20 27 31 35 39 26 29 18 18 25
17 21 34 21 30 43 32 24 41 21 32 26 27 25 23 10 13
9 10 6 10 27 23 19 31 28 37 27 35 38 26 18 16 16
18 16 17 9 28 28 39 34 27 13 8 5 6 17 9 24 28
35 38 14 36 38 38 9 11 15 13 22 22 13 6 8 11 12
24 35 38 22 11 22 16 22 9 11 11 11 22 15 21 12 9
11 9 19 9 18 7 22 27 21 11 9 8 9 7 11 13 12
10 12 13 9 16 12 13 14 9 6 11 15 33 11 9 9 9
8 9 6 9 6 7 9 27 28 11 13 9 9 12 22 10 8
13 13 9 8 11 6 6 10 6 9 9 6 24 8 9 10 19
8 6 6 11 11 11 11 9 11 28 13 9 19 22 27 12 14
14 9 6 9 34 12 10 15 9 11 13 12 10 10 13 12 10
9 12 11 6 8 9 14 14 11 8 11 9 9 7 6 11 11
8 9 10 8 11 10 9 11 9 12 10 14 16 8 19 16 13
9 8 8 11 9 14 12 9 14 12 10 11 13 9 10 9 11
10 6 6 11 9 8 8 9 24 14 11 14 6 8 11 13 9
10 10 22 14 9 8 9 10 9 6 6 10 10 14 9 6 16
15 10 12 12 25 6 12 10 11 9 14 11 8 18 14 10 14
10 24 11 11 11 9 10 9 11 9 11 18 9 9 9 9 11
11 10 13 7 18 14 10 7 10 32 37 18 10 11 14 9 10
11 10 7 9 12 6 8 14 10 9 9 6 10 10 11 9 9
9 8 6 6 12 10 9 9 11 11 16 6 12 9 27 12 19
30 11 9 11 8 13 9 9 13 8 11 10 14 8 5 5