S03036-01_H23
Seqid S03036-01_H23
Sequence >S03036-01_H23.phd
NNNNNNNNNNNNNTTNNNNANNANNNAAGGGCGATTGGCGGCCAAATCGGCCGAATTGAA
TACATATCATAACAGGTTCTCAAAACTTTTTGTTTTAATAATACTAGTAACAAGAAAAAT
GACAGTTCCTTATCTAAATTCAAACAGAAATGTTGCATCATATTTACAATCAAATTCAAG
CCAAGAAAAGACTCTAAAAGAGAGATTTAGCGAAATCTACCCCATCCATGCTCAAGATGT
AAGGCAATTCGTCAAAGAGCATGGAAAAACTAAAATTAGCGATGTTCTATTAGAACAGGT
ATATGGTGGTATGAGAGGTATTCCAGGGAGCGTATGGGAAGGTTCCGTTTTGGACCCAGA
AGACGGTATTCGTTTCAGAGGTCGTACGATCGCCGACATTCAAAAGGACCTGCCCAAGGC
AAAAGGAAGCTCACAACCACTACCAGAAGCTCTCTTTTGGTTATTGCTAACTGGCGAGGT
TCCAACTCAAGCGCAAGTTGAAAACTTATCAGCTGATCTAATGTCAAGATCGGAACTACC
TAGTCATGTCGTTCAACTTTTGGATAATTTACCAAAGGACTTACACCCAATGGCTCAATT
CTCTATTGCTGTAACTGCCTTGGAAAGGCAGTCAAAGTTTGCTAAGGTTAATGCTCAAGG
AATTTCAAGCAAGATTATTGGAGTAAACCTTTTGAANATGAGAATTATCGAAGAAGGATG
GAGAGGAGGAAAAAGGAGACAAGAGGACCCAATGGCCGGATATGCCTAAAAATTGGGGAA
TTTGGGTGNGTCGAAGGGGAGAATTAGTGNGA
Quality >S03036-01_H23.phd
4 3 3 3 3 3 3 4 4 2 2 5 4 10 8 7 7
7 7 9 7 5 8 7 7 6 8 8 9 19 22 10 27 27
15 24 32 17 15 31 21 13 27 14 20 16 44 37 34 25 30
35 36 26 12 28 35 36 20 22 26 31 28 24 43 50 43 29
28 37 35 32 30 21 37 50 37 46 52 49 43 33 31 35 33
32 35 35 49 46 49 39 42 42 42 23 26 27 35 35 34 43
39 46 42 44 35 36 35 35 49 39 32 38 35 39 39 43 43
44 54 44 54 47 60 60 47 60 49 43 41 60 63 58 52 50
49 60 54 49 50 47 50 60 52 45 54 63 60 52 52 63 58
60 63 63 60 63 58 57 57 63 57 57 52 57 63 52 57 60
63 52 57 57 63 57 52 57 52 60 60 58 54 60 63 43 60
60 63 58 52 52 63 63 57 58 60 60 63 57 63 52 63 52
48 46 63 52 52 57 57 57 57 60 57 57 58 52 57 58 63
63 58 52 63 57 52 52 57 63 60 52 57 57 57 52 52 52
57 42 40 23 43 63 42 60 57 52 63 63 57 57 58 60 58
63 57 63 57 60 59 52 63 63 63 63 63 63 63 58 63 52
58 58 63 52 63 52 63 51 45 47 50 63 59 63 57 50 54
50 63 58 58 63 58 59 60 57 63 43 49 50 59 54 63 63
54 63 58 59 54 47 63 58 50 58 44 63 44 50 44 63 51
50 50 49 53 53 45 39 54 54 54 59 54 57 57 50 54 54
42 57 43 54 50 51 50 54 53 47 47 49 49 44 39 54 57
43 54 57 49 54 44 31 50 57 42 43 41 53 54 54 54 57
57 50 42 35 50 26 53 42 54 49 49 49 41 49 50 35 54
50 50 54 54 50 43 54 54 57 50 34 54 54 54 43 59 42
33 50 54 54 49 49 49 35 47 42 53 35 49 49 46 46 39
51 42 49 50 50 50 42 50 35 46 49 46 49 43 49 49 54
54 46 32 32 54 59 41 49 49 46 54 36 46 49 49 49 49
54 30 49 35 24 40 50 18 36 35 54 35 54 54 49 37 36
54 30 49 23 46 32 54 30 46 54 49 35 35 46 59 54 43
46 46 59 46 54 54 35 37 54 59 49 46 37 49 28 35 42
38 33 46 49 46 54 30 38 41 30 41 35 54 23 42 30 43
30 54 27 37 38 43 47 38 33 40 35 38 35 41 54 42 30
59 44 32 49 22 35 46 32 43 30 14 43 42 44 42 39 50
44 34 33 27 44 20 37 42 16 11 16 14 24 33 38 34 59
34 44 22 22 13 19 9 18 18 38 31 42 30 52 44 42 34
34 31 44 26 44 26 22 44 22 36 30 24 44 21 35 36 13
44 28 32 35 35 28 27 16 16 27 17 24 28 35 14 16 13
11 9 12 16 20 35 24 22 16 16 12 9 14 13 14 16 11
19 10 17 16 29 14 10 15 17 12 11 35 46 27 27 35 29
35 32 14 10 18 13 18 13 32 22 41 14 24 16 12 16 33
30 19 11 10 10 11 19 11 13 13 23 32 27 22 11 9 6
13 16 15 12 8 9 10 11 15 12 10 11 9 10 9 10 9
14 14 11 10 18 16 11 26 10 18 18 11 15 40 19 20 16
31 23 11 11 11 16 13 9 11 19 9 9 12 14 11 11 15
19 10 28 10 9 13 28 19 32 11 12 17 11 13 11 14 11
13 16 19 14 32 19 17 15 13 22 26 11 11 11 15 9 11
13 19 17 15 11 15 7 34 8 11 19 11 9 13 14 13 14
23 13 15 14 11 14 12 11 13 16 7 9 24