S03036-01_H24
Seqid S03036-01_H24
Sequence >S03036-01_H24.phd
NNNNNNNNNNNNNNGNNNCNNNNNNNGGGCGATTGGCGGCCAAATCGGCCGAATTTTCAA
AGATGAACATCCAGGTGGTGATGAAATTATAATGGATTTGGGTGGTCAAGATGCTACAGA
AAGCTTTGTCGATATCGGTCATTCTGACGAAGCATTGAGACTACTGAAAGGTTTATACAT
TGGTGACGTTGACAAGACCAGTGAGCGCGTTTCTGTGGAAAAGGTATCTACCTCTGAAAA
CCAAAGTAAAGGTAGTGGTACATTGGTTGTTATATTGGCCATTTTAATGCTAGGTGTTGC
TTATTATTTGTTGAACGAATAATTTTTCTTCCAGAATAGCCCACACTCTTCTCCAAACTC
AATTGAATTTTTCGTTTCAGTTTATTAAATTATTTATTTACAAGCAACCAAGGCCAAATT
AATGTCTTAAAACATTAACTTATGCTACTATATCGCATAGAAGTATGTCACTGTATCATA
GAATCTGCCTGGCAGATAGAATTATTATAAATTAATATGTATATACTTATCTTTGTGTAT
GGCTAAAAATCATCGTCTCATAGATNAAAAAAAAAAAAAAANAAAAAAAAANAAANAAAA
ANANAGGTACNGGGCATNAGGGCCAGCTTGAGTATTCNNTAGTGTCACCTNNNNNNCTTG
GCNNNANTCANGGNCANAGCTNNNNNNGNGTGAAAATGTTANNNNNNCANNANTTCCNNN
CANNNTNCGAGNCNGANGCNNAAGGTGGAAANNNNGNNTTGCTNNANANTTNANCTACTC
ACATNAATTNCGNNGNGTNNNNGGCCANTTTCCACTCGNGAAATNGTCNTGTNACTNCAN
NATAATCGNGNNNNNCANGNNANNNGN
Quality >S03036-01_H24.phd
3 3 3 3 3 5 4 3 4 4 5 5 7 7 13 7 3
5 9 5 3 5 5 3 3 5 12 32 26 11 25 27 16 31
43 20 17 42 21 23 23 12 19 30 48 42 41 28 41 42 41
32 21 27 50 50 35 18 25 18 40 49 29 20 49 44 49 35
35 50 49 30 34 50 51 50 52 52 49 52 29 30 46 34 43
33 35 50 52 52 49 49 50 49 49 31 33 49 51 51 51 53
49 53 42 46 49 43 46 50 42 33 49 50 43 43 49 50 50
50 49 50 54 50 51 53 53 51 46 49 49 43 54 54 50 49
49 50 46 34 46 50 53 51 57 59 41 50 54 54 54 43 57
57 51 53 53 42 50 52 42 57 57 57 57 51 50 50 54 42
42 51 53 51 54 57 54 59 54 57 53 57 52 51 57 42 41
57 57 57 53 42 39 46 53 53 57 43 57 57 53 51 57 57
57 57 52 54 59 59 57 57 57 51 57 59 57 59 57 53 53
57 57 57 54 54 50 57 57 53 57 57 57 59 57 50 50 42
43 42 50 50 50 59 59 57 50 57 53 53 57 57 57 59 59
57 57 50 57 49 49 49 57 53 57 57 57 53 57 57 57 54
54 54 57 57 57 42 50 52 54 57 57 57 57 50 51 51 53
49 50 59 57 53 49 57 54 53 57 50 57 50 54 50 51 54
50 51 53 57 57 53 53 53 51 50 54 53 47 46 54 51 50
59 57 51 53 49 54 57 49 49 35 50 57 54 54 49 49 54
57 57 43 54 43 51 49 53 54 57 57 59 54 43 35 46 49
54 59 46 46 49 54 59 59 57 59 46 53 53 57 57 49 54
57 57 57 54 46 49 51 53 49 49 50 57 54 57 49 49 54
54 49 53 51 49 57 57 54 54 54 40 54 59 57 54 57 54
50 42 49 46 57 54 54 46 49 49 49 49 49 49 49 57 54
49 49 57 49 49 51 49 54 54 51 45 49 51 54 59 54 54
49 57 54 49 49 43 46 54 54 54 54 54 54 54 54 46 46
36 49 49 54 54 46 42 54 54 49 35 47 54 59 59 54 59
46 43 49 54 41 43 37 35 37 35 49 35 37 46 49 42 26
40 28 43 29 37 37 49 47 35 54 54 35 50 46 46 49 47
46 49 49 35 49 46 49 36 52 50 50 41 42 42 37 42 36
52 52 37 43 41 50 50 52 30 52 30 52 35 50 51 30 52
46 35 32 40 43 52 35 28 46 35 37 41 39 40 35 20 46
35 35 29 15 4 12 31 41 28 27 31 28 14 15 12 18 28
26 22 9 5 9 20 21 23 13 19 16 20 10 5 9 12 9
6 18 10 9 26 20 5 9 3 10 8 15 17 9 9 5 12
12 9 8 22 11 7 9 12 37 19 30 25 28 16 18 32 15
15 16 11 15 12 24 36 14 7 7 16 24 12 12 30 14 19
15 21 21 13 7 5 5 5 7 7 22 26 9 17 15 15 7
7 7 9 5 18 16 9 5 9 10 5 23 13 7 12 13 15
9 3 5 5 5 5 5 12 7 8 8 17 21 22 12 9 11
19 10 12 8 5 5 5 7 6 6 9 8 7 5 15 5 21
8 12 15 3 5 7 11 10 5 7 7 17 6 23 14 23 12
6 19 7 9 18 6 14 10 7 5 20 27 8 17 9 23 9
8 11 13 5 5 5 6 17 3 7 12 8 8 17 10 7 7
9 6 11 7 10 8 6 32 6 12 18 12 8 11 8 11 12
25 31 6 24 8 12 10 6 11 10 6 7 8 6 10 9 6
5 5 7 9 13 21 12 9 7 9 8 14 8 35 19 11 10
10 12 5 19 13 21 9 9 6 16 14 11 5 9 12 9 6
11 12 10 5 15 13 7 7 8 10 11 10 17 14 11 7 9
5 5 6 6 6 8 9 6 9 5 7 8 7 5 5 14 6