S03036-01_I01
Seqid S03036-01_I01
Sequence >S03036-01_I01.phd
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANNNNGATTGGCGGCCAAATCGGCCGAAT
TAATAAAGAAACCAAAGTTTCTACAAAAAAAGAAAAGGATAGCATGTTGAACCAGTTGAA
CACAATCTTAAGATTTTTATTCTTGTTTCTGCAGTTAATTAAATCATCCGCTGCAGTTGA
ACCTAATGGTGGACCGAATATTCTAGATCACAACATTATGTTGGTTAACACTAATGCAAC
GATCCCTAAAAAGGAACAAACTGATTTTGAGGTGATTTCTCCAACAAAACAAACAAAAGT
AGATGAAGACTGTAAAAAAGGCTTGTATCATATTGAGAATGCTGGAAATTTGATTGAACT
GCAAGCTAAATGTTGGAAAGTGGTAGGAAACATTGAAATATCAAGTAACTACAGCGGATC
TCTTATTGATCTAGGGTTAATAAGAGAGATAGAGGGAGATCTTATTATCAAGAATAACAA
ACACATTTTTAGAATTCAGGGTTATAATTTAGAGTCTTTGGGAAAGTTGGAATTGGATAG
CCTAACTTCCTTTNNATNATTAGACTTTCCCGCTTTNNNAGAAAGTNNAANCAGTTGAAT
GCANCCCCNNGCNGGGGGCGGGGAAGGGGTGNGGGGACGGATTTATTTTTAAATAACTAN
AATAAGATAAAACTGAGACNGGATTATCNNNATCGNNTTCGTTTTATNGTAAAAAANTGC
CATTNTTTCNTAAGAAAAGTNGGAAAGGGNAGTTATAACGGAAAATTTTAATTATNATTG
AAGAATNAAAAAAAATAAAAGTGAATANGGGGNAGAAANATAAACAATTNTNNNNAAATA
ANTTNGGNCACCTGGGGGNNAAGNANGGAGAGANANAAAAGNACGGTTTAATNNNTTTNN
Quality >S03036-01_I01.phd
4 2 3 3 2 3 3 3 2 4 3 2 3 3 2 4 4
4 5 7 6 3 3 7 7 5 5 7 3 3 5 12 6 5
5 5 28 22 11 35 32 13 12 37 24 13 14 10 13 21 33
26 30 20 30 31 30 25 18 26 28 15 20 29 14 27 21 36
14 28 25 27 36 17 31 36 44 41 41 42 46 42 31 37 17
36 31 33 36 31 20 28 30 33 32 41 50 50 16 16 37 32
40 29 42 49 46 46 46 26 30 32 40 28 41 32 36 40 35
38 37 41 46 36 50 52 52 46 42 46 38 49 42 26 53 53
43 42 43 42 57 49 40 49 49 49 46 49 35 49 42 54 22
54 54 50 49 54 50 50 50 57 53 49 51 50 57 57 57 50
42 42 49 54 50 50 51 51 49 45 46 50 50 50 49 57 57
53 51 54 57 53 29 21 57 54 53 63 60 57 50 51 63 51
58 60 58 49 63 63 49 49 47 49 49 49 50 60 54 57 57
57 63 58 57 52 57 59 60 60 58 52 52 57 57 46 47 43
48 48 43 43 48 48 48 48 52 60 60 63 63 63 58 63 63
57 57 60 57 57 57 60 58 52 52 63 53 53 53 63 52 63
57 60 52 42 60 58 63 58 58 58 52 60 52 57 63 63 63
57 57 63 63 58 57 58 60 60 58 60 58 57 52 52 57 63
57 60 53 46 57 63 60 60 60 60 58 57 58 57 63 46 58
58 63 57 57 57 57 57 60 63 52 63 63 63 57 63 54 52
53 52 57 60 57 57 57 52 52 60 57 57 52 52 60 57 57
48 48 60 57 60 60 48 60 57 48 57 57 57 52 58 52 58
63 63 63 63 63 57 57 60 58 57 60 52 57 53 57 48 57
57 52 57 57 52 57 57 57 57 52 52 47 63 52 57 60 58
57 52 57 52 46 60 57 57 60 52 41 57 57 57 60 57 52
47 60 57 57 48 60 52 52 57 53 48 37 48 32 43 43 40
53 52 48 48 43 48 52 26 57 60 48 35 53 53 48 39 52
27 48 48 43 60 43 27 22 28 20 14 18 27 35 36 34 22
23 33 28 18 20 35 30 42 20 33 32 32 29 34 47 39 42
47 24 29 22 13 32 48 48 26 23 32 35 42 48 47 48 48
52 39 48 27 48 47 48 43 40 35 46 47 43 34 46 28 41
46 35 18 27 40 12 34 39 20 21 16 15 9 11 32 34 35
16 19 34 35 27 28 21 27 10 6 7 16 16 6 9 17 20
18 11 20 29 47 40 29 19 23 21 19 31 35 28 9 7 7
6 13 9 19 16 16 9 11 7 7 14 9 7 9 9 9 12
17 13 12 10 16 9 9 12 6 9 11 10 9 6 7 10 10
6 9 12 13 15 9 12 9 9 9 9 9 9 14 25 27 13
9 9 7 12 18 13 9 19 16 15 14 12 11 11 28 19 25
21 12 9 9 10 10 9 10 10 9 9 9 10 6 9 10 13
20 19 11 14 8 9 26 21 10 10 9 21 18 9 19 10 7
16 9 19 13 9 11 9 9 6 6 7 19 11 8 8 7 6
11 13 10 9 12 9 9 11 20 9 7 11 12 12 13 14 27
23 14 6 10 8 10 9 10 9 11 6 9 11 9 14 7 10
9 9 10 9 9 9 13 9 10 6 11 9 10 12 10 9 24
9 6 9 11 9 11 12 9 10 11 9 10 14 18 12 9 8
24 37 11 11 10 14 10 11 8 9 6 9 9 13 10 18 18
11 24 12 9 6 11 8 13 10 9 20 31 16 8 12 16 12
11 9 9 13 20 24 9 10 7 11 11 14 14 6 15 10 11
14 9 6 14 8 10 14 10 11 10 32 10 10 6 13 6 6
6 6 11 20 12 10 11 9 6 11 8 7 9 8 6 11 9
10 12 8 9 14 9 8 10 7 7 11 10 24 6 10 6 11
11 14 14 9 9 10 6 8 6 14 14 11 9 9 6 14 9
14 10 14 9 9 10 9 11 6 6 6 9 11 10 6 6