S03036-01_I04
Seqid S03036-01_I04
Sequence >S03036-01_I04.phd
NNNNNNNNNNNNGGNNNGGNNCGNNNCNNNNGGGCGATTGGCGGCCAAATCGGCCGAATT
CCCATGGGGATCCGATATCAAGCTTGGGCCCGGTACCGGCCATAAGGGCCAGCTTGAGTA
TTCTATAGTGTCACCTAAATAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAA
ATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCT
GGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCC
AGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCG
GTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTC
GGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAG
GGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAA
NGGCCGCGTTGCTGGCGTTTTTNCATATGGCTCCGCCCCCCTGAAGAGNATCAAAAAATT
NACGCTCAAGTCNGGAAGNGTNGNAGCCGGGGCNGACTANAAAGATAGCAAGCGANTATT
TTTAAANTTNAAACGGNGCGANTCTTATACGGACCTGCCAATAAAANNANNAGGATCAAT
GATCNCATGTANAANGGGNAACGGNTTAAGNNGCGANGNTTGTGAGGTCAGANNTNAGTG
NTAAAAGNNANNNCANCNNCGCGCAACGGGGNTAAANAAGNGAANANNTAATGAATNGGA
CTCCTTCTTNGTCCNGTGANAGGNNCGNANNGANGGGATATGAGTNNACNNTTAGTAATT
TGNTCN
Quality >S03036-01_I04.phd
4 3 2 3 2 5 3 5 3 3 6 7 8 8 7 4 7
11 9 7 3 8 8 5 5 6 9 5 5 5 5 8 13 17
9 22 29 15 34 30 12 10 31 25 14 29 15 24 21 42 35
36 28 38 35 35 26 16 31 44 30 29 30 25 34 36 42 41
41 16 15 40 41 38 43 31 50 38 32 36 41 50 50 49 49
50 46 28 43 49 50 49 49 42 25 34 50 42 42 46 42 29
46 36 46 43 51 43 46 41 35 37 29 43 38 43 42 43 43
46 42 52 52 42 50 52 52 52 52 52 49 49 52 42 49 43
49 49 49 49 52 52 49 49 49 50 42 43 52 50 52 52 50
52 50 52 52 52 52 52 50 52 51 37 47 53 52 49 52 50
52 52 52 53 50 52 49 49 50 46 49 50 53 53 52 42 49
52 49 52 50 52 53 49 52 49 42 53 52 53 52 52 33 52
52 52 43 53 53 49 52 49 51 49 53 49 53 51 50 57 57
54 54 54 59 59 59 49 46 51 59 57 46 43 54 46 47 32
40 36 49 53 53 53 46 49 29 31 29 49 49 49 53 49 54
49 51 52 43 50 50 40 59 50 54 54 37 54 54 54 51 46
54 50 53 49 47 50 54 53 54 50 50 50 50 54 54 42 51
57 46 53 53 51 49 51 47 51 35 53 35 49 51 52 46 53
53 44 51 51 30 50 49 49 46 43 49 49 50 25 47 32 41
49 49 49 46 36 41 52 46 49 37 49 51 52 41 49 46 42
32 52 27 51 43 41 49 35 49 32 30 45 39 32 21 42 30
50 31 49 49 21 46 45 50 28 49 46 52 46 52 52 52 52
36 42 47 49 49 49 51 35 51 50 47 52 49 35 50 49 38
54 54 51 38 59 40 54 54 54 40 54 46 54 50 50 59 59
40 54 50 54 37 54 54 49 49 35 49 35 43 54 35 54 46
46 38 50 31 49 50 32 46 54 54 35 46 37 46 41 54 54
54 38 40 49 49 46 34 20 42 35 46 26 42 51 28 28 46
41 35 41 35 42 20 29 31 42 35 40 32 21 9 20 38 33
33 39 20 30 50 34 35 21 15 18 46 50 35 30 24 9 17
13 13 17 16 30 23 29 31 29 40 39 35 49 22 44 12 50
50 50 39 44 12 32 27 24 29 20 26 27 14 15 33 9 27
32 33 24 26 33 22 30 28 42 42 42 41 18 7 14 24 14
33 38 42 35 38 20 27 29 42 31 35 25 20 32 47 26 35
30 6 19 13 23 13 10 12 11 12 46 38 14 18 14 33 26
17 21 28 17 31 20 12 8 42 14 6 9 20 10 11 9 13
14 30 18 9 11 7 14 26 8 9 11 16 13 18 23 14 23
6 11 9 16 9 11 7 9 8 6 9 6 11 9 9 12 14
9 9 9 9 6 14 32 11 12 19 7 10 13 10 12 17 16
8 11 12 12 12 28 10 11 10 7 14 9 9 9 10 11 15
11 11 12 6 10 14 7 8 9 9 10 8 21 6 11 10 8
9 6 9 28 8 9 9 14 10 9 9 11 9 13 12 10 9
9 10 12 12 10 9 12 11 11 6 6 19 6 6 9 9 11
10 9 10 19 11 9 9 11 12 9 6 13 10 9 8 11 11
6 11 9 7 10 11 9 7 8 11 8 16 10 6 9 10 10
15 10 6 6 9 11 14 11 7 13 7 9 9 10 8 9 10
10 11 10 9 8 14 9 6 6 9 7 11 9 10 10 6 9
16 10 10 17 9 6 6 12 6 7 6 10 13 7 8 6 7
9 8 8 11 8 8 9 10 9 9 11 11 6 12 14 12 10
6 11 9 8 6 10 11 19 6 14 6 6 10 9 9 13 14
10 8 8 6 14 9 14 9 10 8 14 10 10 9 8 9 7
10 10 14 14 6 9 10 10 14 7 14 14 14 7 6 9 9
6 8 6 6 14 14 6 9 9 11 8 9 11 9 9 11 14
11 6 6 14 9 6 6 9 20 13 10 9 9 10 9 9 8
9 6 11 11 6