S03036-01_I05
Seqid S03036-01_I05
Sequence >S03036-01_I05.phd
GNNNNNNNNNNTNNNNNNNNNNNNANNNNNGGGCGATTGGCGGCCAAATCGGCCGAATTG
AAGCAGAANAGGACTTTTTCGCAAAAACATTAACATATATAAAACTAGCGCTATGGCCGC
AACTAAAGAAGCAAAGCAACCAAAGGAACCAAAGAAGAGGACCACCAGGAGAAAGAAGGA
TCCTAACGCCCCTAAGAGGGGCTTGTCAGCTTACATGTTCTTTGCTAATGAAAACAGAGA
TATTGTCCGTTCCGAGAATCCTGACGTAACTTTTGGCCAAGTAGGCAGAATATTGGGTGA
GAAGTGGAAGGCCTTAACTGCTGAAGAAAAGCAACCCTATGAATCTAAGGCTCAAGCAGA
CAAGAAGAGATACGAATCTGAAAAGGAATTGTACAATGCTACACGTGCTTAATCTAACAA
CTCAATGTTCTCTACCCCCCATACAACGTACTTTTGAAACTTCAGAAAGAAGTTGAGTAG
GTTGCATTATGTGTTATTATTATTACTATTATCATTATTTTACTTATATATCCTTCTTTT
CTTTTATGTATTCTCTTCCTTTTTCGCACNNNAAANAAAAAAAAAAAAAAAAAACACCNC
TCCCCCNCACCAGCAGGGGAGNNGGGGGCCGGCCATAAGGGCCATNTTGTATATTTNTAA
AAAGACACACAAAANANCCTGGCCGTAATCATGGTCNTANNTTGTTTCNGGGGGAAAAAT
GTAATNCNNTANNNTTNNNNNNANNNNNNNAGCCGNNANNNNAAANNNNAAAGCCCNTNT
TTTCTTNAATNANNGAATAAANAAACATTAATGGNGTTCGCCTTCNTGCCTGTTTTCCAG
TTAGGAAAAANNNNAAGACACANNTNNNCTCATNCNNNNAGCNANCGAGGGGAGGAGGNN
GGATAGCAANTAGGGTNTTTTTTTCTTTCNTNGNACNAGAACNT
Quality >S03036-01_I05.phd
12 7 5 3 2 3 3 3 4 5 5 11 6 4 3 2 5
5 5 3 3 5 3 5 11 3 5 3 5 7 8 23 19 16
25 27 16 32 31 14 12 31 16 16 26 11 10 24 36 30 29
17 28 29 23 18 15 28 34 21 10 10 9 28 30 37 43 14
5 17 36 36 17 14 47 47 49 45 30 29 31 41 26 19 26
27 24 46 30 29 38 36 36 35 23 35 28 30 25 30 21 28
28 36 49 42 34 46 49 30 29 28 26 29 31 35 26 35 42
43 42 50 42 42 43 46 34 43 43 49 43 52 35 32 41 43
52 50 46 49 46 36 46 46 50 46 42 40 42 59 54 54 49
49 53 47 49 57 38 49 35 20 43 43 43 43 49 52 53 35
39 30 49 54 49 47 37 29 40 30 29 35 34 31 43 36 35
31 31 34 39 41 42 46 49 42 57 38 46 49 50 43 53 43
53 49 49 49 46 45 46 50 49 54 54 54 54 49 49 54 54
54 49 49 43 42 37 35 46 49 49 50 46 39 46 35 40 45
32 30 29 26 24 37 34 37 32 32 40 51 45 46 43 43 50
43 52 50 54 46 40 41 46 42 42 43 49 42 46 46 49 57
51 43 43 42 43 50 40 46 49 49 49 49 51 49 50 51 53
49 49 45 43 51 53 49 51 49 53 51 49 51 49 50 50 49
46 50 50 50 42 36 46 46 49 50 49 49 49 51 49 49 51
53 53 43 57 53 53 49 54 54 46 43 44 43 43 45 50 54
54 50 49 49 49 46 43 42 32 44 36 42 46 35 39 44 54
42 42 42 42 33 38 42 44 38 42 50 44 33 32 42 44 42
49 49 54 54 49 49 57 51 43 44 44 46 46 36 44 51 44
44 44 49 42 44 44 49 47 44 60 60 42 49 59 60 60 50
60 49 60 49 47 60 47 49 49 47 42 47 60 47 42 44 47
54 54 50 49 60 60 43 44 60 47 38 38 40 47 47 50 60
54 50 44 60 60 60 60 54 47 60 49 60 47 47 47 41 43
60 60 60 40 33 31 32 20 20 21 33 24 35 40 35 35 47
35 42 35 27 35 28 35 47 24 35 47 39 32 35 49 17 44
22 15 28 25 39 39 36 34 42 39 39 50 54 50 54 59 42
42 39 39 35 54 54 35 46 51 49 42 29 42 42 50 31 39
39 34 46 21 35 39 27 39 39 27 35 29 26 33 16 29 33
30 34 21 33 19 31 30 37 37 30 35 30 42 35 42 33 46
50 43 54 30 24 31 19 31 7 7 7 10 9 12 7 22 24
30 27 28 27 26 34 17 40 32 28 24 26 19 21 10 10 9
10 16 9 5 12 11 28 23 28 27 22 7 22 8 10 12 9
13 11 9 11 16 9 12 10 10 5 5 9 12 13 8 9 10
9 16 18 10 12 17 22 21 16 18 28 16 15 20 15 11 7
34 49 10 13 8 21 11 32 13 9 6 9 9 9 9 9 9
21 10 10 13 10 11 11 14 28 31 28 7 12 6 10 8 21
16 25 15 22 18 10 11 18 10 17 11 17 27 17 11 11 7
12 12 7 6 12 10 11 17 27 14 11 6 12 22 18 15 10
8 16 16 18 11 11 11 14 8 17 9 6 9 6 6 9 8
5 5 5 10 16 6 5 5 3 3 3 9 6 6 6 6 6
5 7 8 9 9 11 9 5 7 9 5 6 5 5 8 9 16
7 3 3 5 17 26 25 14 26 12 9 6 9 6 12 12 18
8 12 9 16 7 10 9 13 5 9 6 7 8 18 13 13 30
27 11 7 11 14 20 10 13 12 9 16 15 10 11 12 7 9
9 10 11 11 12 17 24 9 16 7 16 11 16 8 9 14 8
23 37 38 9 17 18 11 11 8 11 17 21 14 15 27 19 17
6 6 6 6 16 11 8 19 15 8 8 8 7 6 9 6 6
7 9 9 20 8 13 6 10 7 7 6 6 10 14 17 7 9
6 12 14 19 13 27 27 21 9 23 15 9 10 17 7 6 18
16 11 13 11 30 14 15 10 7 27 13 12 12 10 10 7 19
23 35 27 27 14 15 9 13 14 12 11 7 19 6 12 6 13
10 6 9 10 10 12 8 6 8