S03036-01_I08
Seqid S03036-01_I08
Sequence >S03036-01_I08.phd
NNNNNNNNNGNNNTNGNNNNNANNNATNGGAGATTGGCGGCCAAATCGGCCGAATTGGTC
TTGTATCATATACTAAAGGAACTAATTCAATCTCAGGGAACCGTAAAGGTTTATCGCGGT
AGTAGTTTTTCACACGATTCGATAAAGATAAGCTTACATTATGAAGAGCAGCATATTACA
GCCGTATGGGTCTACTTGACAGTAAAATTTGAAGAGCATTGGAAGCCTGTTGATGTAGAG
GTCGAGTTTAGATGCAAGTTCAAGGAGCGAAAGGTGGATGGGTAGGTTATATAGGGATAT
AGCACAGAGATATATAGCAGGGAGATACTTTTGATCTAAAAAAAAAAAAAAAAAAAAAAA
AAAANTATTATTAANAAAAAAAAAAAATTACCGGCAATCNGGCCCGCTTTCCCATTCCGG
TAGTGAGGACAGGGGGCATTAGGNTCTGTTTTTTTTGTGGNAANNNATAATTAAATATTG
TGTTTATTTAAANAAAGNAAAAAGTGNANNACTCTTNTNCACGGCAGNAGGAGATAGAGG
ANGNTGAAGNNGGAANTTANNNNTCCCNAATCGGATNAGTTAGAGGTGNTGAAGGAAATA
ANGGATNNGAACCATGTANCTCTNGNAGGGGNGGAGGNGNNNANNTGGNNAAANTTGTNN
GTNCNGATCGCANACAANNACNANGAGTGGGTTNGNAAGTANNNAGAANNCGGANNTNNN
NNCNANGNNTNNTGNNATNNGNNGGTGNAANNAAAAAAANANATAGNNNNNGNCNNNAAN
NANANNNNGAGAGTTAGTCCCCGACGTNGNGCAGNNGTTNTGNTGNGAGGGNNACCANNC
TTANGCNCANCGAAAAA
Quality >S03036-01_I08.phd
7 6 5 4 3 4 2 2 3 8 5 7 3 8 5 10 5
5 5 5 5 9 7 7 7 16 9 7 22 19 9 10 15 8
18 26 15 10 12 13 21 18 15 23 12 29 30 17 20 28 35
35 42 17 21 35 36 28 28 36 29 36 46 34 28 36 29 22
28 42 41 38 38 33 28 15 21 26 39 23 26 32 30 18 17
18 32 32 21 28 42 47 39 33 35 35 47 47 33 28 22 27
35 35 47 34 42 52 52 57 60 52 60 52 52 46 46 60 40
40 47 39 35 40 35 60 63 63 63 63 52 57 57 53 63 48
63 63 63 63 58 63 60 57 60 57 48 48 52 57 53 57 57
57 52 57 60 52 53 48 57 57 57 63 53 53 63 63 60 60
57 48 43 60 60 52 43 48 60 47 47 48 43 43 52 47 60
48 48 40 48 57 52 57 52 60 52 52 52 57 52 57 52 57
60 43 48 52 60 48 57 52 48 60 63 60 60 57 52 57 52
57 52 60 60 57 57 57 60 63 63 57 48 52 63 57 52 60
53 52 63 60 58 57 58 53 58 63 58 48 48 63 52 57 57
60 63 60 58 60 52 45 60 57 58 48 53 53 52 57 58 60
53 63 39 57 60 52 53 57 60 53 53 24 22 27 31 35 27
19 18 27 19 19 26 26 14 18 9 13 13 18 23 10 20 12
11 12 13 11 9 10 11 9 19 16 11 9 10 10 11 11 27
18 20 32 10 14 27 36 26 17 20 9 9 9 10 9 10 9
9 18 18 31 23 22 32 20 14 39 53 42 45 19 28 31 17
18 11 13 14 22 16 20 6 11 9 11 9 9 13 29 11 9
6 9 13 9 11 22 31 41 15 12 23 23 11 11 10 9 12
16 9 11 9 9 8 9 9 6 11 11 11 28 20 9 9 9
9 9 13 13 11 9 14 22 20 11 12 10 11 13 9 9 13
9 9 10 8 10 9 16 9 12 9 10 8 11 18 14 11 11
11 6 8 10 9 9 9 12 13 20 15 13 9 26 10 19 9
10 6 10 8 6 6 7 10 9 22 13 13 10 11 19 12 11
9 13 10 9 9 9 11 10 15 12 12 8 9 10 28 16 6
11 16 8 9 6 11 13 14 14 10 11 11 9 7 28 6 6
9 13 11 9 11 10 6 8 6 9 13 10 12 13 11 10 9
6 11 14 40 18 11 8 11 10 17 10 14 17 14 6 9 6
9 14 11 9 9 6 6 9 9 8 11 6 9 24 15 6 6
6 7 14 8 9 12 7 9 9 9 8 9 14 12 8 6 12
14 8 9 11 11 9 10 10 10 8 6 9 8 14 9 9 10
9 12 8 11 8 19 6 9 10 11 11 6 6 9 8 11 10
9 11 10 11 11 8 6 14 11 8 10 6 14 6 11 11 9
14 9 6 9 27 9 22 9 5 12 6 6 5 10 5 6 9
10 10 7 5 11 21 8 6 14 14 9 19 6 5 10 11 7
11 6 8 14 11 17 9 9 19 5 8 8 8 9 6 5 19
10 7 13 5 10 10 9 20 12 8 14 11 10 6 9 5 13
12 10 11 8 7 6 6 9 10 11 10 5 5 9 9 11 11
5 7 11 6 5 5 6 6 10 5 14 5 10 5 5 9 5
5 11 12 6 5 10 9 5 5 11 5 5 12 8 11 10 5
13 14 6 6 10 10 8 14 10 11 8 7 15 7 11 10 8
17 5 5 5 5 6 18 5 9 7 7 5 8 14 7 5 11
6 9 6 5 6 6 10 17 9 10 11 9 9 14 11 11 11
11 8 10 8 10 11 11 8 6 8 7 14 9 17 8 5 5
9 11 11 7 9 14 7 9 14 5 9 11 10 9 8 5 5
14 8 9 10 5 5 9 11 9 14 6 9 9 6 12 14 5
8 10 18 10 14 11 14