S03036-01_I09
Seqid S03036-01_I09
Sequence >S03036-01_I09.phd
GNNNNNNNNTNNNNAANNAANNNANNNGGGCGATTGGCGGCCAATCGGCCGAATTGAGGT
AGCAATGGTTCTTCTATAAAAGTGCAAGCTCTATAAAATCAAGATCAAGCATAGTACCGC
CCACTGTTAGAGTCTTTGGTACGCAAACATTTTTGGCTACCGGATGTTGCGAAGAGAACT
AAATAACTCTATCAGCAACAGGTCGATAGAAAATGAATCCTTTCCTTTTGAAAGGCCGAA
TGTCAGCTATATAATATCCGCAGAATTTGATAATAAATTAGGTCCTATTTTGAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGGTACCGG
CCATAAGGGCCAGCTTGAGTATTCTATAGTGTCACCTAAATAGCTTGGCGTAATCATGGT
CATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCG
GAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGNNNTAACTCANATTAATTGGGT
TGCGCTCACTGCCCNCTTTCCAATCGGNAACNTGTCGNGACAGNTGTNNNNTTNAATTCN
CNCCGTGGNNANNAGGNAANAACCNTAGTGCACTCCNATTACTGTGGCGAATAGNAAATT
TGGNAGCTCAACAANTTANTCCTGACAAAAAAGNANNAAAGNAANAGCGCANGCTAAATA
GNTAATNCAGAANTNAGATNCGNNTNNNGGGNAGGGCNNTGGTCTNNNGNNANNNNANGT
GGGNTAAAAATNNCAGACNCAGGGANTGNNAGANNGNNNAGGNCANNTNNTNNAAAGANN
NGATTATGNNGNNNNCGGGNNNTCTTAATANNGNATCAATAGGCNTNCATTAN
Quality >S03036-01_I09.phd
9 6 4 3 2 2 2 3 6 9 2 5 5 5 8 8 5
5 11 9 5 7 5 8 3 3 7 9 19 16 12 16 25 16
28 29 15 14 30 17 17 16 15 15 31 25 21 22 17 16 15
16 21 23 24 15 18 11 16 36 31 35 29 28 28 31 32 19
24 31 31 30 26 30 26 31 21 45 43 43 45 33 35 35 37
30 27 36 51 43 35 21 26 20 21 21 18 30 31 30 27 27
33 42 30 31 30 28 33 26 19 28 35 26 15 17 23 27 27
24 21 25 36 31 30 28 34 23 35 35 50 41 42 41 53 43
46 38 27 31 42 33 35 46 46 50 47 49 49 54 54 54 43
46 49 42 38 42 54 50 54 57 54 45 54 54 51 51 51 50
54 50 54 41 45 50 50 50 44 50 42 54 54 50 39 37 30
43 49 52 49 53 50 50 49 50 49 43 46 50 51 53 43 46
43 57 49 53 44 53 53 43 42 30 49 50 54 54 54 49 44
44 44 49 49 50 49 49 49 46 44 46 46 50 33 17 20 32
42 36 36 49 42 39 39 42 44 44 50 54 50 54 54 53 57
54 54 54 49 50 59 59 44 57 50 50 53 51 51 43 42 57
53 54 57 53 50 50 51 51 54 57 54 54 54 50 57 50 51
53 57 59 57 57 57 57 57 54 54 46 46 54 43 43 35 35
46 54 54 49 46 37 38 28 24 22 26 35 35 32 35 30 27
22 22 17 26 22 22 21 19 15 9 15 16 16 26 35 35 35
49 49 49 49 35 35 37 35 37 43 37 28 10 18 22 16 28
29 27 33 33 29 25 30 28 34 41 42 29 29 30 21 21 21
33 28 32 30 28 26 20 36 28 26 21 30 30 35 16 21 26
28 30 28 37 27 20 33 45 49 22 46 23 34 36 33 35 26
28 29 32 36 24 19 21 16 28 36 36 19 31 40 33 38 27
28 32 46 36 32 28 34 19 12 29 13 49 10 30 35 34 36
24 25 29 31 34 22 34 35 26 21 17 24 29 20 21 37 25
45 40 18 24 11 15 12 12 15 16 25 25 30 27 18 8 29
18 29 26 17 19 30 23 15 16 17 12 27 18 18 19 18 26
15 16 22 35 23 31 37 21 36 23 23 26 16 29 28 23 29
18 21 28 28 28 19 25 27 7 3 7 12 21 22 25 18 12
16 6 29 26 15 18 23 28 20 14 9 10 22 16 9 10 11
30 17 22 21 20 14 19 13 16 13 5 15 16 21 13 12 10
8 10 18 22 18 9 7 20 19 11 5 9 15 9 9 9 6
17 9 11 27 11 7 21 21 10 6 6 6 7 9 14 7 9
9 15 8 10 6 11 6 9 9 9 9 9 9 7 7 9 6
6 10 12 12 6 9 9 6 9 9 9 9 6 17 10 10 9
8 11 10 12 10 10 12 6 11 10 10 9 9 12 9 9 10
10 14 14 10 14 14 13 13 7 9 11 11 12 11 11 10 11
7 11 16 10 21 9 11 10 9 14 10 7 10 9 8 7 9
10 10 10 10 13 11 19 21 36 30 9 10 10 6 9 6 6
19 10 15 9 6 9 11 7 11 8 11 8 9 11 6 11 9
9 10 12 8 8 9 9 6 10 10 9 8 5 12 18 11 9
10 6 8 6 9 14 10 9 6 9 10 6 6 8 6 6 6
8 8 11 6 8 8 9 11 10 5 5 8 9 9 8 10 11
6 6 6 11 6 5 10 6 6 6 6 10 6 8 11 10 9
11 7 8 9 8 11 14 14 9 6 6 9 10 9 10 8 6
11 9 8 14 9 18 6 9 10 6 6 14 10 10 6 6 11
7 6 6 9 9 8 6 9 8 6 6 8 6 6 9 7 7
14 9 18 11 10 6 6 7 10 9 8 11 9 11 11 6 6
10 6 6 6 6 9 9 10 8 6 6 6 9 8 8 9 8
10 9 10 6 6 8 6 10 10 10 8 9 10 10 8 10 11
6 11 6 9 11 9 8 11 5