S03036-01_I10
Seqid S03036-01_I10
Sequence >S03036-01_I10.phd
TNNNNNNNTNNNAAGNNNNGGNNNATANGGANANTGGCGGCNNNTCGGCCGAATTTGGAA
CAAGAACATAAAAAATTGTTTTTGCTACATTGGTTTCACATAACATATTTCAACAAACAT
GCCATCAAATTTGAATATAGTGAAGGTTACAAAACCACAAGAAGAAAATAAGAATATTTT
ACACAAAAACACGAATGAACCCAATGAAATGGAACAATCGCAGACACAAGAAGCAGTTAC
AGAAAATTTTACCGAAAACAGTAATCTCAGTGCAAATGAACATGCAGCTAGGAGGGGTAG
ATTAAATTTGAAAACAGTTGATCACATAGAAACTTATCCAATAGTGCAAGAAACAGAAGA
GATTGCAAAAAAGATTGCTCTAACGAGAATTATTTTAGCACAAACAAAGCCTAGAATCGA
TAAAGTGGTAGTGTCACGTCCCGTTCAAGCCGTAGCACCAGTGGTCAATTTTNNTGACAA
GATGGCCAATTCGNCTTTAAGTACNGTAGNGCGCGGTGTCCCATCTTTGNAAAGAAAAAN
TTATAACANNTNAAGGTGACAAANTGGNAANATCGCGGNGTTTCTAGGAAAGGGCGGNNN
GCCCATTACNTAGTTAAAGNANGAATGGGAAAAAGTAATCATTGGNCCTTAACAGAGAAG
AGANCCGANNCTNAANCGATTATACTATGGANGGNNANNACGNANNNAGNGCACCTCNGG
GGTGTATANTACGGGNNGANNNAGGGNTGAGTTCATTGAAATTTTAAANNGGGACAAGGG
NNAGGAAGCTTAAGTAGGGCTCAGGTTTGATATNACCNGGNGGNGGTAGCNCACAGAGAG
TACCGNGNNGANNGNCANGGNGNNGATAAATNNGCTTGAGGCANAGN
Quality >S03036-01_I10.phd
11 3 3 3 5 4 4 3 11 6 6 6 10 10 12 7 3
7 5 8 10 3 6 7 8 9 9 5 9 24 9 6 10 5
9 27 18 17 21 17 15 7 5 7 18 26 31 23 26 20 29
19 16 31 35 37 35 31 20 25 29 16 17 28 30 34 27 33
44 34 35 36 41 32 32 26 35 35 25 37 43 37 36 31 31
28 35 35 27 46 42 38 30 32 32 30 38 20 49 29 44 35
39 38 42 42 43 42 35 22 27 19 22 36 12 22 20 21 21
39 46 42 44 38 50 44 44 60 60 54 60 60 60 47 60 47
47 49 42 40 40 49 47 49 50 54 52 52 47 50 44 47 49
47 42 42 39 47 44 54 49 50 60 50 63 47 49 49 49 51
58 60 52 52 54 57 52 60 60 52 57 57 52 52 52 60 60
60 57 57 52 58 60 57 57 63 63 63 57 52 57 52 52 60
60 58 52 60 57 52 57 57 57 57 57 57 57 60 52 52 57
52 46 52 60 60 60 46 57 60 52 60 60 60 47 60 57 46
42 47 25 46 47 42 40 44 52 60 60 52 57 57 57 60 58
58 60 52 57 42 60 52 57 60 57 57 57 52 52 63 57 57
57 60 52 45 52 63 58 60 46 60 52 57 49 49 60 50 47
54 49 63 63 29 63 60 51 42 54 47 45 28 50 50 50 50
50 60 49 51 49 49 47 60 47 35 60 50 49 47 44 28 49
44 47 42 49 47 60 45 49 54 47 44 49 44 60 42 37 23
60 49 49 50 47 50 42 44 47 60 44 37 34 31 35 47 44
38 32 43 27 25 15 33 45 42 22 49 44 50 60 49 47 42
19 49 50 24 40 44 44 47 47 47 47 47 50 49 49 42 49
50 44 54 46 41 42 47 60 47 44 44 47 60 47 44 54 54
47 47 47 47 42 42 49 47 27 35 26 33 35 49 50 60 57
60 57 52 42 57 47 52 52 42 29 21 22 22 43 35 35 44
52 32 42 35 31 31 33 23 21 36 35 43 33 47 35 30 48
24 28 23 22 8 16 18 20 30 19 21 18 12 5 5 27 29
15 29 35 45 20 22 25 35 31 15 26 25 35 35 39 28 11
7 8 8 27 34 24 39 42 32 13 15 6 14 28 28 12 6
10 14 13 11 16 18 9 28 14 23 19 23 11 18 13 23 32
24 10 6 9 10 9 9 8 14 28 20 22 7 12 11 9 11
9 17 8 9 6 6 11 7 25 23 14 34 27 21 38 11 10
14 9 7 34 16 9 6 9 10 6 9 8 16 9 10 8 10
6 14 9 12 9 12 9 10 10 9 9 16 11 10 8 10 9
11 10 6 6 6 12 12 14 11 10 10 11 11 11 7 9 15
12 13 11 17 19 11 9 6 9 7 9 10 11 9 9 8 10
9 9 9 10 14 12 18 11 14 12 13 15 8 10 9 10 7
11 14 17 15 17 17 8 9 11 8 8 11 8 11 10 11 16
6 8 8 10 9 6 6 10 9 6 9 8 7 10 9 11 30
11 14 10 10 11 11 9 9 10 11 9 7 8 9 6 6 8
6 6 11 9 8 6 8 6 6 6 12 9 6 8 11 9 9
9 10 9 7 14 14 14 14 8 9 11 11 14 9 7 10 10
11 11 10 9 6 6 11 9 6 7 6 9 9 14 9 6 9
10 9 8 9 9 8 10 10 11 10 14 14 10 16 10 11 10
20 14 9 6 6 9 9 10 11 10 10 10 9 9 9 6 6
14 14 10 10 10 9 8 11 10 8 9 9 10 11 8 10 11
16 9 11 9 10 10 9 9 9 9 8 8 11 9 6 11 8
9 6 9 8 6 10 8 6 10 10 8 9 8 9 6 9 9
9 14 10 10 15 9 10 8 11 10 8 10 7 11 6 6 9
11 6 6 9 6 9 10 7 8 8 6 14 6 6 11 9 11
9 11 14 9 7 7 9 10 8 9 9 20 8 9 9 14 6
11 8 6