S03036-01_I11
Seqid S03036-01_I11
Sequence >S03036-01_I11.phd
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCGATTGGCGGCCAAATCGGCCGAATTA
ACCAAGCAAATTAAGATCACAATGGCTGCTGAAAAAATCTTGACCCCAGAATCTCAGTTG
AAGAAGTCTAAGGCTCAACAAAAGACTGCTGAACAAGTCGCTGCTGAAAGAGCTGCTCGT
AAGGCTGCTAACAAGGAAAAGAGAGCCATTATTTTGGAAAGAAACGCCGCTTACCAAAAG
GAATACGAAACTGCTGAGAGAAACATCATCCAAGCTAAGCGTGATGCCAAGGCTGCTGGT
TCCTACTACGTCGAAGCTCAACACAAGTTGGTCTTCGTTGTCAGAATCAAGGGTATTAAC
AAGATCCCACCTAAGCCAAGAAAGGTTCTACAATTGCTAAGATTGACAAGAATCAACTCT
GGTACATTCGTCAAAGTTACCAAGGCTACTTTGGAACTATTGAAGTTGATTGAACCATAC
GTTGCTTACGGTTACCCATCCTACTCTACTATTAGACAATTGGTCTACAAGAGAGGTTTC
GGTAAGATCAACAAGCAAAGAGTCCCATTGTCCGACAATGCTATCATCGAAGCCAACTTG
GGTAANTATGGTATCTTGTCCATTGACGATTTGATTCACGAAATCTTCTCTGTTGGTCCA
CACTTCAAGCAAGCTAACAACTTTTTTGTGGCCTTTCCAAAGCTCGANNNNGNTTAANGN
ANGGGGNACCTTTCGGTATCNTTNANAAATNAATAAACAAAAGGGTTAGGCCCCGGACCT
GAACGGGTGNANTAAAAATAAATATAATAANAAATAACACACACNCCTACCCCNNTCGGN
GAGGGAGGAGGGGGGGNGNTNNNATTTTTTTTTTTTTTTATNATTTTCNNNAAAAAAGAN
Quality >S03036-01_I11.phd
6 2 3 3 2 4 3 2 2 5 4 3 4 5 5 3 6
3 6 6 6 7 5 5 3 4 5 5 6 7 5 10 28 12
19 21 12 19 23 9 8 24 18 10 15 8 9 11 30 19 28
22 23 14 13 17 9 22 19 11 12 14 12 10 13 33 27 25
26 29 41 31 15 27 28 35 20 27 31 33 36 34 41 42 37
33 35 44 41 42 41 25 42 41 38 31 29 30 35 28 30 40
24 40 40 40 38 28 31 30 30 36 35 30 32 30 35 40 41
41 29 26 32 35 33 33 49 50 45 40 44 26 25 30 46 46
34 34 51 46 40 40 37 35 42 32 46 49 35 40 52 39 49
50 49 46 46 53 50 50 51 47 53 51 53 50 42 52 52 50
50 49 50 49 46 43 43 46 37 42 46 49 42 42 41 49 49
39 39 43 49 54 54 51 45 51 53 53 53 53 49 53 47 53
49 51 57 57 53 42 49 50 49 49 49 54 54 54 49 46 49
49 46 43 43 35 53 53 49 51 49 50 49 44 35 36 43 43
34 31 43 31 29 30 35 33 39 54 49 49 57 57 53 53 46
49 45 44 45 44 49 60 49 47 60 50 50 47 60 49 44 49
51 54 60 57 58 60 60 51 49 60 63 58 44 63 47 63 49
58 57 63 51 63 58 50 59 58 63 49 45 47 49 50 60 44
44 49 49 49 49 60 49 63 60 50 57 58 54 60 63 50 60
60 50 63 60 63 63 63 58 58 51 57 59 59 60 51 47 60
60 49 47 60 49 49 49 49 47 60 60 47 42 43 47 44 54
49 47 49 40 43 60 44 35 40 44 47 60 49 54 54 54 60
60 63 50 49 63 49 63 49 60 50 50 47 63 47 47 32 24
24 38 43 43 43 43 47 47 43 46 58 27 47 47 47 47 54
59 59 57 49 43 54 54 54 54 49 54 54 51 51 43 50 54
42 52 51 50 49 49 50 43 49 49 49 46 46 46 49 50 50
49 49 51 54 54 54 50 46 43 46 46 49 50 49 46 49 50
50 50 51 45 30 32 37 43 38 29 23 37 49 34 40 40 49
29 46 40 40 33 46 43 50 37 39 39 36 35 35 50 20 39
31 29 27 30 32 40 42 40 43 50 42 49 40 40 42 43 50
46 40 51 35 24 42 44 33 39 35 46 37 35 35 37 37 37
36 30 47 35 50 15 40 31 46 26 46 43 43 35 49 24 46
46 35 42 30 37 28 35 38 28 35 36 41 25 37 46 35 46
28 32 27 28 28 26 49 46 35 21 27 43 35 43 30 21 40
33 46 35 40 35 31 28 30 30 31 20 49 35 16 33 33 18
37 28 29 35 28 29 23 22 21 19 6 25 15 21 23 26 10
20 19 21 16 16 19 11 8 9 9 14 11 18 20 14 18 28
13 20 28 27 18 21 29 19 13 12 9 15 28 22 33 16 12
30 13 10 17 32 29 28 36 26 26 28 30 34 19 19 14 15
10 21 16 20 15 20 14 14 15 34 24 22 16 20 21 14 14
24 32 38 37 36 37 12 11 15 13 20 14 20 13 27 29 13
13 14 13 16 11 10 16 14 11 11 6 6 6 6 9 7 9
9 10 10 7 13 7 12 6 14 13 19 19 5 9 10 10 24
21 26 10 18 16 16 11 9 11 7 16 27 7 11 6 18 19
16 19 6 12 11 9 14 15 16 8 23 28 9 21 16 26 23
9 9 9 12 9 17 16 14 11 9 9 11 11 9 11 12 13
8 16 15 11 10 11 8 7 9 6 15 13 14 12 11 10 12
26 12 9 15 26 9 20 11 9 8 9 6 8 17 15 8 16
25 11 8 18 8 14 12 22 7 38 17 12 8 15 9 9 9
6 6 9 10 9 27 7 11 12 14 26 10 8 12 14 8 17
30 28 18 34 14 9 5 9 6 9 6 7 7 9 13 20 17
20 22 11 26 21 34 32 28 34 15 12 13 10 13 7 12 14
13 10 12 9 5 6 7 11 22 11 22 13 16 8 11 7