S03036-01_I13
Seqid S03036-01_I13
Sequence >S03036-01_I13.phd
NNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGCGATTGGCGGCCAATCGGCCGAATTGATA
TATTCTTTCTGTCTCAACCTTCGTTTCCTTGGATGAATTATTTTGATTGAGCTCCAAAAA
AAAAGTTGTAGCCAGGAACTATCCAAAACTTCGATTGAGAAACCCATAACAATGATGCCT
GCCAGACTTTTCATACTATATCTTTTTGTAGTACTCATGCCTGTTGTTCATTGTTCGTCC
AACCTGCCCATCACTCCATATATCTATGAGCGTCTAGTATATTTTATTAAGGCAAGCTCT
ATATCAAGCTGCATATCTGACAACTTACTTCTTGTTAATAAAACCTTCAACGACGGAGGT
TGTCCACCACATATTAACTTCTGCAATGATGAGATAATTAACCCAACAGCGGGTCAAACA
GNGGTTGAATTAGTTCTTAATGCAAAAAAAGGTGAATTAGGCTCGGGGTATCTGGCNGTT
GACCACGGGNAAAAAGGTTGTTATTTTAGCATTTAGAGGATCCACAACNAGACCAGATTG
GTTTTAAGATGAAGAAAGATTANCNGATAANNATTNCGCCCAATACCTTTAAGCANAAAC
GCAANTGATTGANNGGGAAGAGAAATATAGAANGTGAAAATTGAATGAAACAAGAGCAGA
GTCAAANGGAAAAAAAAATGGTCGGCANAGGANGGGAGTGATAANTNGAAAAATNNATTG
AAAAGGTNACNANCNGGGGAGGAAGNNGGANGGNAACGTNNGTTATTTNGATNGAAAGAA
AAAAAAAAGNGNANGGNNGANATCCCAGCANNAAAAANGNAATTGNTCAGAANGACTCAG
TATANTCTACNCTCNATANNGGNCAGGCGACGCGNGGTACNNAGGAACNATGAAGAAANA
CNTNNNNGGAGTANGGNAGTNN
Quality >S03036-01_I13.phd
5 2 3 3 3 2 2 3 3 3 4 4 6 5 5 3 3
5 6 5 3 5 3 3 3 3 5 7 10 32 24 12 25 27
13 25 29 18 11 35 27 14 16 21 29 33 43 41 31 29 35
27 21 15 16 34 25 10 24 20 28 31 21 41 51 44 51 43
40 35 35 36 35 44 23 35 29 35 42 40 46 49 37 40 46
37 46 42 40 49 41 33 22 21 34 28 34 26 32 37 26 46
46 49 49 43 28 40 46 43 54 43 47 49 43 35 35 40 35
40 46 39 39 46 50 46 47 41 40 40 36 49 44 28 49 50
42 43 34 45 32 49 46 42 30 49 46 45 50 51 51 47 49
52 50 63 63 50 50 45 49 50 47 63 51 50 49 46 43 49
54 50 60 63 58 50 63 57 58 57 60 60 52 57 52 63 52
63 63 63 58 57 44 63 57 63 58 52 63 60 63 63 60 60
57 60 60 57 47 57 57 52 60 52 57 63 39 60 60 60 57
57 59 60 48 60 57 48 48 57 48 43 48 47 26 26 37 30
14 11 11 13 13 11 26 57 57 60 57 52 63 57 60 52 58
60 57 57 58 57 60 57 63 60 52 57 57 63 63 57 63 58
58 52 53 57 52 52 57 60 57 52 60 60 57 60 52 63 60
58 57 63 47 60 52 57 59 57 48 48 52 60 60 48 52 40
48 60 52 46 57 40 35 60 57 57 60 47 60 43 30 46 60
60 57 48 48 60 57 60 48 57 60 57 24 34 47 57 57 57
60 57 57 57 48 47 60 52 35 48 43 48 57 60 46 63 52
28 52 47 57 57 41 57 60 41 52 57 60 46 47 46 60 57
52 47 52 52 52 60 34 48 52 57 46 60 46 57 46 46 42
52 41 52 29 42 60 52 52 42 48 35 52 57 42 52 52 46
60 52 47 48 28 23 15 11 43 48 41 46 9 7 8 20 40
57 28 35 32 29 35 22 14 34 48 16 25 40 47 52 28 46
23 22 32 15 48 48 33 18 20 29 16 41 23 20 16 16 13
9 24 9 9 9 9 14 16 9 13 13 30 37 19 19 18 9
7 23 32 32 35 24 22 24 26 23 20 13 19 6 11 18 20
21 32 9 23 11 19 12 14 19 9 13 13 9 10 8 10 24
9 16 28 18 18 11 21 9 13 32 21 19 26 13 33 28 11
10 6 13 13 16 11 9 11 10 19 11 11 22 19 13 9 11
12 13 9 14 11 10 14 19 9 9 18 9 9 9 13 11 11
11 6 8 6 19 15 20 11 20 7 6 9 9 9 6 9 11
8 10 16 11 8 10 11 11 9 9 12 8 13 12 8 9 11
6 9 17 10 9 10 11 12 9 6 8 9 9 8 11 13 9
7 7 16 12 8 10 9 9 9 11 22 24 17 17 19 11 28
13 18 9 6 18 11 10 10 14 12 9 10 14 11 10 11 9
11 11 14 20 12 12 15 10 14 11 14 17 10 11 11 14 13
11 15 11 7 10 10 10 13 12 9 10 9 17 23 9 9 12
16 9 9 16 11 9 9 6 8 11 13 9 7 9 12 10 9
10 10 12 9 9 9 9 6 8 6 9 16 13 10 8 10 11
6 6 10 11 14 9 9 13 15 17 13 9 10 6 11 9 7
9 6 8 6 9 14 10 9 9 9 9 11 10 11 6 6 9
21 8 6 10 12 6 9 10 10 11 10 6 7 9 9 11 14
9 11 10 6 9 14 9 6 11 12 12 14 9 9 18 11 19
10 11 11 18 10 9 9 6 10 6 11 6 15 9 6 6 9
9 6 9 8 9 11 9 19 12 9 9 6 6 14 10 10 12
10 6 9 6 14 9 9 16 9 6 10 9 9 9 10 9 6
11 8 8 9 8 11 10 19 10 9 11 6 9 9 9 11 9
6 11 11 14 6 9 9 9 6 7 11 8 6 11 10 10 8
11 19 10 9 9 8 8 6 8 11 10 11 8 6 6 9 8
9 9 10 8 7 9 9 11 10 11 9 9 12 10 6 10 11
5 11 7 5 5 7 14 10 14 10 8 10 6 10 10 6 14
10 11 5 5