S03036-01_I15
Seqid S03036-01_I15
Sequence >S03036-01_I15.phd
NNNNNNNNNNNNNCNGNNNCNNGNNANNGGCGATTGGNGGCCAGTCGGCCGATTGAACCA
CGTTTCTCAACAAGAAGGACCTAATAGAGGAAATTTATTATACTGTAGCTATCAATATTT
TATAAACAAAAAGACAGATATATTCTCGCGTATTGAAGTCGGGAATCCAACGAAGGTAAA
ATAATAATAAAATACGAAGCATTTTATCCGGTCAAATGTACAAGAACTATTATTCAAACA
CAGAAGTTTATAAAAAGCATAAAGACTCTGGAAGTTTGAGGAAGAAAGCTTTGAGATCGA
GAAGATCATCTTTTTTTTCATTTTTCAATGACTCGTCTAGTTCGAATGGAAACGAATTCA
TAGGTTTTAGACGATTTGCAAAAGCATATCTGTTTGGTCACGAGATAGGTTCATGTGGGA
CAGATTCATATACACCAGTTGGGGCAAATGTAGACAAAAAACNTCTACAACAAGCCGGCA
ACCNCNAGNAGCNGGGGTGGAAAAGGCAGCACCTTTCAGANGGTTGANNTAAAAAAAAAG
AAAAAAGGAACGNAGGTCCCAAATGGTNGGAACGGTTNNNAGAAGAAAAAAAAAAAAAAA
AACCACCCCCCGCNCNGNGGGGGGGGGGGAGGNGGGGGGGNATTTTTTTNTTTTTTTTTT
TTTGCGACCAAACANAAAAAGGGGGGGGNAGGGGACATGAGNGACNTAAGTGAAAANANA
AAAAACCTNACAACCCNNACCCCNCCGNGGGGGGGGGGGGNGGAGGGGGGATANTTATAT
TTTTNTAATGCNAGAGNAAAAAAGACGAAANNGNGCNGANANGNCNATAAGNGATGCAAA
AGNNNACACCAAANCAAACNNNANNCGGNGGGGCGGNGGNGGNGGNGGGGGGGNGGNNGN
NNTGTTTTTANTAANCCANN
Quality >S03036-01_I15.phd
7 4 4 5 4 4 4 4 2 3 3 6 6 8 6 11 7
5 3 8 6 7 8 7 5 11 6 5 13 10 9 12 19 9
11 16 8 7 31 19 9 9 9 9 18 27 27 24 17 19 21
24 9 14 18 9 8 10 16 18 29 31 29 22 28 25 30 19
26 23 20 31 30 14 27 26 24 40 15 12 40 18 12 15 18
32 26 44 35 32 27 15 19 16 15 12 16 20 29 33 34 28
30 25 43 18 28 24 33 11 23 25 21 12 12 16 26 26 28
24 16 29 32 29 34 34 38 32 36 29 29 28 39 33 49 30
42 43 46 43 50 42 42 49 49 49 53 45 46 43 30 46 35
43 43 43 43 46 46 49 44 43 46 44 47 42 50 47 60 50
60 49 49 44 34 51 43 60 47 43 43 49 60 60 47 40 41
43 57 60 60 52 60 60 52 57 43 41 42 43 53 48 60 60
52 57 60 57 60 43 43 35 57 35 40 47 42 57 46 47 43
25 32 30 48 52 52 40 40 34 27 36 27 30 29 27 20 35
26 23 35 30 44 48 48 60 60 43 43 53 43 43 43 57 60
60 57 60 60 60 52 57 53 60 52 53 53 58 57 58 58 63
63 45 57 53 53 58 57 52 63 53 53 57 63 63 63 52 52
60 60 60 53 43 53 48 53 57 60 57 57 52 53 53 52 30
53 53 53 53 53 53 60 58 53 53 60 53 53 53 57 53 53
53 53 52 53 57 57 53 43 43 39 39 38 42 45 23 34 34
25 27 38 18 34 38 33 53 34 34 27 27 37 18 41 53 45
53 53 40 24 42 42 53 27 40 34 34 45 53 53 53 53 53
53 63 52 53 53 53 53 60 53 31 53 36 42 34 38 53 38
43 38 39 35 53 53 44 43 33 42 24 53 24 37 31 35 14
35 35 53 53 42 42 29 18 27 27 10 18 25 20 40 42 35
27 38 33 25 38 37 19 37 25 42 38 23 23 47 47 53 53
48 37 20 32 42 53 28 35 18 33 10 42 20 32 31 46 16
10 9 11 6 9 9 10 8 8 9 9 8 8 10 11 11 9
8 9 11 8 9 10 11 6 10 6 14 9 6 10 13 9 6
18 10 9 11 10 18 24 13 11 9 20 10 11 10 11 12 15
11 9 11 9 13 14 11 11 9 11 6 21 14 13 14 20 10
7 6 9 9 14 11 19 11 14 28 34 23 9 14 16 12 9
9 9 11 11 10 8 8 11 7 8 9 10 12 9 8 14 9
10 19 9 9 8 10 6 10 9 10 9 10 12 9 11 10 6
6 7 12 11 14 10 11 18 17 37 53 53 9 9 11 11 14
11 10 10 11 11 10 10 9 8 8 13 14 11 11 10 9 9
9 6 9 6 11 6 11 14 19 13 12 23 23 23 38 21 16
9 11 11 6 11 11 9 12 10 14 12 5 8 9 19 12 9
9 11 10 7 12 10 10 16 16 12 14 14 14 10 10 9 10
10 14 10 9 9 9 19 10 14 9 11 6 10 10 9 9 11
10 12 14 9 9 12 12 12 6 11 8 11 11 9 9 10 17
14 9 10 11 7 10 9 11 6 10 9 9 14 10 23 18 9
9 11 6 9 6 34 16 14 10 11 14 10 10 9 6 9 10
8 11 11 14 8 5 6 8 9 8 8 11 5 8 10 9 6
11 10 16 14 9 14 12 12 24 16 14 9 6 10 9 9 11
8 19 8 9 12 12 10 11 6 11 9 10 13 9 19 14 12
12 8 6 9 9 8 9 11 11 6 14 11 9 8 6 12 27
26 14 28 24 9 13 9 9 23 12 9 6 6 11 6 10 8
6 8 9 6 11 5 8 6 9 6 10 13 22 14 8 6 17
14 9 12 10 12 9 9 23 9 6 6 6 16 8 11 10 11
12 9 10 6 10 9 8 8 8 7 6 6 9 6 5 10 9
8 6 10 10 9 9 10 9 10 5 8 11 5 10 8 5 10
8 5 11 9 8 8 9 8 9 6 14 9 5 5 11 5 5
7 10 8 11 14 10 8 10 11 6 11 11 12 5 8 8 8
7 5