S03036-01_I17
Seqid S03036-01_I17
Sequence >S03036-01_I17.phd
GNNNNNNNNNTNNTNANNCNCNNGNAATAAGNNTNTCGGCGGNCGNTCGGCCGAATTCCC
CCGCAACGCCAGTCCAGCTTCCTTGGAATATGTCGAAGCTCTTTATCAATTTGATCCTCA
ACAAGATGGTGATTTGGGCTTAAAACCAGGTGACAAGGTCCAACTTTTAGAAAAGTTATC
TCCAGAGTGGTACAAGGGTAGCTGTAATGGCCGTACCGGTATTTTCCCAGCAAACTACGT
CAAGCCAGCTTTCTCTGGTTCTAACGGTCCATCCAATCTTCCACCACCTCCACAGTATAA
AGCTCAAGAATTACAACAAATCCCCACGCAAAATAGTGCCGCATCATCTTATCAACAGCA
GCCATTTCCTCCACCTTCCACAAATTATTATCAGCAGCCTCAACAACAGCCGCAACAAGC
TCCTCCTCCCCAACAACAACAACAACAACAACAACATCAGAGCTCACATAGCCACTTGAA
GAGCTTTGGTAGCAAATTGGGTAATGCCGCCATTTTTGGGGCAGGCGCTAGTATTGGGTC
GGATATTATTAATAATATCTTTTAAATCGTTTTTCTCTTTANNTACTTCATTNAATTNTN
CTCCATTACGGCCAANCCTTTNAGGGNGGGGNNGAAATTCTACCTTTNGTGTTGNTATTC
CAGAATTTTAAATCCNGGGNNTATGGANTTNAGTAAACTTTNTNAAGTTTTTATTNAAAA
ANAAATANACCCCCCCCGCNGATTAANCGGNNAGGGGNNNNGGGAGGTGGGANANTGTCN
NTNTTTATTTAAAAATATTAAAAAGAAAGCGTNAGGGTTNNTGTTTNTTAAGAGAAAATA
NNAAAAGTGNCCNATCGNCTTATCCCCCCCTGCGGGNNGGGGGGGGGGGGGGAAAGGAGA
NGNNGTCAACTCAAANAAANN
Quality >S03036-01_I17.phd
8 5 5 2 3 3 2 2 2 5 11 5 5 8 6 8 5
5 11 6 12 6 5 9 7 10 14 11 13 10 10 6 6 9
6 9 11 15 11 13 33 19 7 12 9 6 16 16 20 16 15
16 17 16 9 19 24 18 12 14 12 12 15 16 11 11 18 24
20 25 11 29 26 25 20 32 30 24 28 29 32 29 30 28 28
18 10 10 21 27 30 32 35 29 33 26 35 17 32 30 32 22
24 17 23 28 22 20 14 16 19 14 27 28 28 35 35 36 33
35 36 21 26 26 26 33 35 50 47 42 38 30 34 58 50 50
49 47 47 49 47 35 47 60 57 52 52 46 59 60 39 52 48
42 35 43 43 63 45 57 52 57 60 52 57 48 36 27 34 40
48 60 42 57 57 57 58 57 58 57 57 57 52 52 52 63 58
58 63 63 57 52 63 57 63 63 63 53 53 57 60 52 57 60
52 43 48 52 57 48 48 60 48 35 44 43 43 43 60 52 57
52 60 60 57 57 53 53 37 43 24 35 27 24 19 20 29 20
35 27 20 15 35 53 53 43 53 60 57 57 57 52 52 52 53
52 52 52 57 53 53 52 52 53 53 60 57 57 57 52 53 60
57 52 53 53 53 57 60 57 60 52 57 52 52 57 57 57 52
60 52 57 57 57 52 52 60 60 57 57 57 57 52 52 57 57
57 60 57 53 52 52 60 57 52 53 53 52 60 53 57 60 58
57 58 60 60 53 53 60 63 60 57 57 53 60 57 52 57 57
52 57 60 60 57 53 53 53 53 53 60 57 52 42 45 44 35
35 35 34 39 34 22 27 29 29 29 35 35 39 45 45 53 53
53 53 60 53 57 60 53 57 60 43 43 53 45 53 53 44 53
53 53 45 53 53 60 57 60 57 57 60 53 45 60 63 52 48
44 53 44 43 60 60 60 57 60 48 43 43 52 52 43 43 53
45 43 35 44 44 43 41 52 52 39 42 52 41 52 52 37 43
52 47 48 35 37 52 52 29 48 48 41 35 43 42 60 52 48
48 48 32 40 42 47 39 30 35 37 37 37 42 46 35 40 20
23 37 42 44 46 52 47 30 42 42 35 43 34 22 24 26 12
12 23 29 19 29 47 48 31 19 22 47 35 47 22 43 22 22
19 13 18 27 41 40 29 47 47 35 60 39 35 35 52 35 17
20 25 29 28 19 27 16 22 27 24 27 22 31 39 40 35 16
23 20 17 22 19 16 27 39 33 29 38 35 31 31 42 32 46
34 36 21 26 40 28 28 24 11 17 19 33 42 35 27 29 11
21 11 11 7 7 9 14 14 13 21 9 12 10 12 7 9 13
11 10 6 9 7 21 12 9 12 9 11 17 15 9 12 24 19
24 22 8 6 9 9 9 11 12 6 10 8 8 10 6 11 11
17 10 7 6 15 17 14 8 8 9 13 21 28 14 17 17 17
11 6 11 20 9 13 23 10 7 11 9 28 25 12 16 12 8
9 18 9 14 9 9 12 13 9 11 20 9 6 8 9 19 6
6 9 11 18 17 12 13 7 16 10 6 19 16 13 9 13 14
14 30 12 14 6 14 6 9 8 10 9 9 9 10 10 10 10
9 7 23 27 25 22 14 7 11 9 19 10 11 6 9 9 10
9 13 16 14 13 16 9 9 6 13 10 8 8 9 9 7 8
9 12 6 6 8 11 24 12 10 7 6 6 7 25 9 36 13
14 9 9 10 11 16 13 7 11 6 9 8 10 9 6 6 9
6 23 11 12 9 13 9 9 20 18 13 39 13 11 9 9 13
11 19 13 11 11 15 22 11 18 11 9 9 8 6 9 9 13
13 16 16 6 6 11 10 8 11 11 7 11 9 9 9 9 9
10 12 10 12 31 16 13 6 6 11 9 25 12 23 8 8 6
9 11 6 23 10 9 9 6 9 9 9 11 11 9 25 9 17
9 9 10 11 14 9 16 20 15 6 6 11 37 14 36 40 35
26 16 19 38 13 14 14 10 9 11 8 9 14 26 20 10 7
14 6 6 9 9 9 10 12 10 11 9 13 18 18 6 23 28
20 6 6