S03036-01_I18
Seqid S03036-01_I18
Sequence >S03036-01_I18.phd
NNNNNNNNNNNNNNNCAGNNNNNNNNNNGGGCGATTGGCGGCCAATCGGCCGAATTGAGT
TATACAAATAACAAACAATAGAAAAATGTTTAGACAGTGTGCTAAAAGATATGCATCTTC
ATTACCCCCAAATGCTTTGAAACCCGCATTTGGCCCACCAGATAAAGTGGCAGCTCAAAA
ATTTAAAGAATCATTAATGGCTACTGAAAAGCATGCGAAGGACACATCTAATATGTGGGT
TAAAATCTCAGTTTGGGTCGCCCTACCAGCAATTGCTTTAACAGCTGTGAACACATACTT
TGTTGAAAAGGAGCATGCTGAGCATCGTGAACATTTGAAACATGTGCCAGACTCCGAATG
GCCAAGGGATTACGAATTTATGAATATCAGGTCTAAGCCTTTTTTCTGGGGTGACGGTGA
TAAGACATTATTCTGGAATCCTGTTGTCAACAGGCACATCGAGCACGACGATTAATTAAT
TGATTAAGTGAGAATAAACTTTTCGAAAAATTTTTATTTATGATAATTTTACTAATTCTT
ACTTATTTCTTTTATATTCGATAAAAAAATTCAAAATAAAAAAAGATTAATCCTTTGATA
GGAACTAAAGGTACTAGGTATTTTGGGCGGCNANCATCATTCCGTTCTNNNCATCTATAT
ATATAATTATNTTGCAATGTATAAGCATTTNAANATAAACATGCACCTATGAANAAAANA
CNNACNNNANACNAGNNCCGGCCNATAAGNNNANNNNNNNNNNNATNNTGTCACCTAATA
NNNANNCGNAAANAANGGGCNTNNNGNTTCCTGTGNGNAANNGTTTGNNGTNANATNAAA
CAACNTACNNCNNAAGCTTAAAGGGTAANGCAGGGNNNNNNTNNATNNN
Quality >S03036-01_I18.phd
5 5 2 2 3 3 3 3 3 5 5 6 5 5 3 9 11
16 5 5 7 3 5 5 5 3 3 5 10 23 28 14 24 29
13 28 31 12 15 41 24 13 9 9 9 40 31 34 29 40 31
41 27 15 30 41 36 30 35 40 37 30 26 31 37 30 43 47
41 47 49 33 36 47 50 30 30 49 51 50 40 38 46 35 37
35 29 42 44 49 38 42 50 42 49 32 46 36 49 37 50 42
42 43 35 37 37 43 42 27 35 30 42 40 37 52 50 49 46
43 42 49 50 54 52 49 49 49 50 42 49 49 49 54 50 49
46 49 50 54 59 54 50 49 54 59 57 57 57 57 51 53 44
43 51 50 54 52 57 54 54 57 54 54 49 49 49 57 57 52
59 59 54 50 50 49 49 49 49 49 49 50 53 51 49 54 59
59 59 57 42 57 51 53 53 53 47 51 53 43 53 57 54 53
51 53 47 46 49 54 54 51 49 51 54 49 54 54 54 43 54
30 31 54 54 46 54 54 50 49 49 46 49 41 49 54 57 53
47 36 36 40 46 46 49 49 49 54 50 50 57 57 53 53 53
53 51 49 50 44 42 54 49 50 54 50 50 35 54 52 54 57
50 57 57 51 53 53 50 49 57 54 35 51 57 57 57 54 51
51 49 54 59 59 46 57 54 57 57 53 53 54 54 57 54 50
49 49 52 54 57 57 54 54 54 42 57 50 57 51 57 33 57
49 54 57 54 54 57 51 47 49 54 43 59 59 54 50 49 49
49 41 50 49 49 49 49 50 32 46 50 36 49 49 49 46 50
49 46 53 49 21 50 37 49 37 47 42 29 20 49 50 42 52
51 46 46 53 51 49 46 52 51 49 49 49 50 51 52 42 51
49 52 51 43 52 52 49 46 49 52 52 52 52 52 52 49 52
52 51 50 43 52 42 33 52 53 49 52 42 31 52 49 49 50
41 41 50 52 42 50 53 40 46 51 51 43 41 36 46 50 49
52 32 52 51 42 36 34 51 46 37 42 52 42 36 49 46 49
49 40 49 49 49 46 42 50 49 49 34 41 30 41 36 40 40
46 28 40 37 49 51 38 28 46 30 23 45 46 49 36 30 23
20 20 21 21 35 37 49 49 49 49 40 46 43 28 34 34 41
31 43 47 47 47 34 40 51 51 29 40 49 41 19 46 32 28
49 45 29 32 44 38 50 50 26 40 38 35 46 49 42 32 40
46 38 36 36 32 26 49 49 49 37 50 37 40 28 30 21 42
50 29 49 34 23 20 37 34 26 51 31 23 15 15 45 38 31
21 18 15 15 21 20 22 13 9 15 14 15 25 36 49 31 31
33 30 26 29 26 8 22 13 13 29 28 13 13 13 14 17 16
28 44 21 30 23 45 20 29 23 27 19 16 22 29 49 19 18
35 16 5 16 5 21 21 28 31 28 32 22 8 12 22 23 45
20 17 5 3 5 21 21 41 23 16 35 28 41 35 31 33 43
26 15 15 15 35 32 11 7 10 24 26 18 33 21 21 31 20
21 30 13 26 31 38 23 40 31 12 5 10 8 6 9 30 14
37 47 23 18 38 26 21 30 28 17 10 13 11 20 23 9 3
8 13 11 8 3 8 9 5 5 9 9 5 5 6 9 6 11
9 6 12 11 6 7 9 18 27 19 12 21 6 10 15 17 8
8 7 5 6 13 7 7 7 3 5 7 6 5 7 7 7 10
8 6 6 26 9 11 9 9 9 12 15 18 21 20 10 6 6
6 9 7 5 9 12 6 25 16 10 6 12 10 6 18 16 10
9 5 11 6 6 6 9 6 16 18 12 14 10 12 9 10 5
8 5 11 8 5 5 9 11 10 9 9 6 6 11 12 6 10
7 15 8 5 9 9 9 14 23 20 9 7 9 12 12 5 6
11 5 7 12 24 9 12 15 13 21 22 14 9 9 16 11 11
12 5 9 11 10 18 18 13 6 6 6 5 6 7 9 6 6
9 9 6 5 5