S03036-01_I19
Seqid S03036-01_I19
Sequence >S03036-01_I19.phd
GNNNNNNNNNNNNTTAANCNNCNNNNNNANGGCGATTGGCGGCCANTCGGCCGAATTGAT
ATCAGGTCCTTGCTCCTTCAGGTATATCTATATGCTCTCATAGAATTATATTTGATATTG
CTTTTTGGACCACATCAAAATAAAAGGAGCTCGAAAAAACTGAAAGGCGTAGAAAGGAAT
GGGTATCCAAGGTCTTCTTCCTCAGTTAAAGCCCATACAGAATCCAGTATCACTACGTAG
GTATGAAGGAGAAGTGTTAGCCATTGATGGCTATGCATGGCTACATAGAGCAGCCTGCTC
TTGTGCTTATGAACTTGCAATGGGAAAATCAACTGATAAGTACCTCCAGTTTTTCATAAA
AAGATTTAGTTTATTGAAAACCTTTAAAGTTGAACCGTATTTGGTCTTCGATGGTGATGC
CATTCCAGTTTAAAAGTCTACTGAATCTAAAANAAAGGATAAGAGAAAANNNNCCCAAGN
CATAGNAAAAAAGAGGGTGGGCCTGTGTTTAANATTNTTATGCTATGAACNATTTNCANA
ATGCGGCTNNTCATNTTCTTNATTGGAAAAAAAANAAAAAAAAATNAAATCANNTTNNCT
TNNANAAGGNNNANNNAGGAGNAAAGANTNNTTTTNTTCAAAATTAAAAAAAAAAAANNN
NGCNNGGGNNTCATCNTGGTTNTTTCAAAANAAAAAAAANNTANAAANCCNNNNTTGCCG
NAGGGGGGGGGGNGAAGNGAAAAAGTTTTTTTTCTTCANNAAAAAAAACANCNNGTAGCC
NCNNCGCNNATTTAANATAANNANANGAAAAAAGNNACCCCNCNNGGNNNGCAGGGGGGG
GGGGGGGGGAGGAANNTGATATNNTGTAAANNNA
Quality >S03036-01_I19.phd
11 5 4 5 6 5 4 5 3 3 4 2 5 8 8 12 8
5 8 5 6 9 6 5 5 5 6 5 11 5 9 10 12 25
25 18 23 21 9 10 22 31 11 9 11 7 19 14 15 14 13
12 9 15 10 8 12 9 9 13 9 24 12 26 19 31 14 12
11 18 25 22 21 21 15 16 21 28 21 19 28 46 22 21 26
21 27 19 26 31 29 27 35 41 35 27 29 27 30 23 32 25
21 21 20 15 15 15 12 20 11 11 19 29 29 28 27 28 35
32 18 20 20 27 39 44 33 27 44 18 27 27 42 47 60 47
42 42 47 42 47 47 44 47 47 42 46 42 46 57 44 43 41
41 63 43 33 24 29 35 60 44 52 40 40 35 42 20 43 35
43 32 35 21 24 35 35 35 47 35 57 47 40 47 35 35 35
40 47 52 60 57 52 57 52 52 57 60 48 48 43 48 57 57
42 52 46 47 60 47 48 40 43 43 40 52 60 53 39 30 48
44 37 44 44 45 45 45 47 35 27 20 15 26 22 35 30 30
35 28 27 35 35 31 35 53 53 43 53 43 21 53 53 42 57
53 53 44 44 23 31 27 35 53 53 53 53 35 57 52 52 52
60 52 53 60 60 53 60 53 35 37 53 60 53 60 57 60 53
43 53 57 53 43 43 43 43 44 43 44 53 53 53 53 53 35
44 30 39 37 53 53 43 53 53 43 53 53 43 43 41 53 36
35 43 63 53 53 33 53 60 48 39 57 57 35 35 47 53 36
35 39 35 20 29 35 45 36 30 30 36 30 24 20 19 25 19
23 17 19 19 19 19 28 12 19 18 28 35 36 35 44 48 43
43 43 43 48 43 35 27 24 35 33 20 28 29 20 27 27 34
24 40 30 26 30 40 41 35 22 28 20 32 35 24 29 29 28
32 16 42 35 48 30 20 30 30 26 42 18 24 22 37 30 23
15 14 19 30 37 10 19 20 9 11 11 19 24 22 35 23 28
28 20 14 9 12 9 17 24 24 30 6 53 48 20 15 13 22
16 19 19 10 21 9 12 22 9 9 6 6 6 6 9 19 10
8 9 16 6 9 9 9 10 12 7 9 10 10 12 12 9 9
16 9 9 16 17 34 21 17 11 12 32 16 12 8 16 9 9
9 11 6 10 17 9 7 12 13 21 16 8 13 17 22 12 10
9 10 9 6 17 9 9 9 7 9 9 6 9 13 9 19 9
15 9 13 10 7 7 10 9 9 10 7 8 11 11 22 15 6
13 9 24 13 9 15 33 22 9 12 18 12 12 6 21 47 35
27 35 35 42 47 9 8 6 15 19 10 9 9 8 6 7 8
8 7 6 9 11 10 6 7 10 7 9 9 8 9 7 7 6
8 6 6 7 9 8 11 9 8 7 9 8 9 8 10 6 9
7 7 10 8 9 14 7 10 9 8 8 9 9 9 17 14 11
12 20 25 22 33 30 44 31 37 18 12 7 7 7 6 11 9
6 6 8 9 13 6 6 8 9 11 9 9 6 22 9 11 11
12 6 19 21 14 8 13 29 16 11 6 10 35 40 22 23 11
13 14 6 6 9 8 6 13 9 9 7 9 9 6 7 6 5
9 8 8 11 9 9 6 9 9 12 9 10 11 9 18 14 22
14 6 14 10 10 10 5 10 19 10 22 10 9 8 10 14 9
11 26 31 23 11 8 14 14 8 12 6 6 13 18 26 23 32
23 18 13 9 20 6 13 6 6 9 8 10 9 9 9 7 20
6 6 9 8 8 6 6 9 9 11 9 16 19 6 8 10 14
29 6 6 10 6 34 5 8 12 34 16 10 20 16 9 7 7
13 10 15 14 8 6 23 6 7 8 10 7 6 6 10 9 14
11 16 20 15 16 13 35 23 9 16 19 10 9 11 18 12 11
9 11 9 12 6 7 11 8 11 13 11 11 6 6 15 9 11
8 9 18 6 6 6 16