S03036-01_I20
Seqid S03036-01_I20
Sequence >S03036-01_I20.phd
NNNNNNNNNNNNNNNAAGCNNNAANNNNNNAGCGATTGNGNGGCCAAATCGGCCGAATTG
ACACAGACAAAATAATTGAAAAATGGACGGTATGTTTGCTATGCCAGGCGCAGCTGCAGG
TGCGGCCTCCCCACAACAACCAAAATCAAGATTCCAAGCTTTCAAGGAATCTCCACTATA
CACAATTGCACTAAACGGTGCCTTCTTCGTTGCAGGTGTTGCGTTTATTCAATCTCCACT
CATGGACATGTTGGCCCCACAATTATAAGGGGTTGGTTCTTGTATAGTTGAGATTTTTTC
ACTTACCTGTATATATATTGGTTTTTGGGTTCTCAAAAGAATTTGTCANCTATGTTTATA
TTTTATTCCCGAATTATGTAGAGTTAGCTGTGTATATAATGGTAAAAAAAGCAAGTATGC
TTTACCACNAATTNATTTTTGTAAAAAAAAAANAAACAAAAAAAAGTNCCNGCCCTCCCC
CCACCTTGGGTATTCGAAAGAGTCACNNNAATATTTTGTCTTATTTATGGTCATAACTGN
GTCCAGAGGGGAAAAGTTNATCTGTTCNANTTCTNAAAAAAATAAAAAACAGAACATACA
CCTCNCACCCCNCNNANNNCCNNNANNNGNGANNAAGGNGNTNTANNNNCTTNTNGANAN
TACAAANATGCGAGACNAGATNACCTTTCGCTCTNAGTCCTTTTANTGATGNNNAAAAAA
AAAGCNANCACCNTTCCCACATCNANGGAGAGAGAGAGGGAGGAGGANGAGNGNTATTCT
TTTTTTAGNNTCATAGAGGAAAGAGGAAAAGAGNNGANGTCNTANCTNATGGTTTATTTT
TATTTTNNAAAAATAAAAGACCAAACACCACCNNCNNACNNNNNNNAGANNGGAAGGGGN
NNGACAAGTG
Quality >S03036-01_I20.phd
7 3 2 3 3 3 4 3 3 2 4 3 4 7 5 9 8
9 14 7 7 5 9 10 6 3 5 6 6 5 9 8 8 14
28 12 16 15 6 9 7 10 12 13 10 11 11 10 31 27 28
20 24 31 19 21 15 30 21 12 10 12 12 15 10 13 26 27
21 18 15 15 34 21 30 26 35 30 33 37 35 35 31 16 36
31 31 42 30 42 29 32 29 42 35 29 28 32 28 18 17 29
22 30 38 29 39 44 42 39 42 27 35 47 44 47 47 31 38
50 44 49 47 47 41 44 47 44 52 57 52 46 47 47 34 35
47 44 57 57 52 44 57 52 57 52 46 39 35 42 52 46 45
43 44 42 57 57 46 46 57 52 57 57 52 52 48 52 60 52
52 52 60 57 60 52 52 52 52 40 40 35 52 47 60 57 52
57 57 57 52 52 52 60 57 57 57 60 53 53 53 53 43 53
48 60 52 57 57 60 48 48 48 40 40 60 52 57 57 48 48
52 52 57 60 40 42 40 35 43 22 43 47 57 40 40 32 35
20 21 32 28 34 48 48 48 52 57 57 57 48 60 52 52 57
60 60 48 35 60 42 52 48 53 35 43 35 57 57 53 48 48
43 53 48 48 40 60 60 60 57 57 42 60 46 52 52 57 60
57 57 42 52 47 57 48 60 48 43 20 18 43 43 53 35 52
40 48 48 30 35 32 35 47 32 47 43 26 30 30 34 26 60
60 40 40 43 23 20 32 40 60 47 46 30 43 30 28 29 13
10 12 20 27 20 18 21 14 7 9 11 28 24 22 18 18 27
35 23 22 22 19 13 12 18 13 16 28 25 28 28 47 47 34
46 42 42 60 40 48 39 48 20 43 35 13 10 12 9 9 29
22 16 11 35 12 41 19 13 21 22 10 12 12 20 46 47 57
44 35 29 29 23 9 14 23 29 24 25 22 24 27 35 23 35
10 11 11 6 13 15 15 11 6 9 9 9 11 11 9 9 10
15 19 12 9 20 12 13 23 31 16 6 17 11 10 8 12 29
43 16 14 10 16 42 20 9 6 21 15 6 10 16 19 10 16
9 9 8 9 19 9 10 10 19 15 19 11 11 14 12 19 11
10 9 12 23 12 22 15 13 21 8 9 9 9 6 7 7 12
9 13 15 16 16 23 28 11 20 14 13 16 9 12 12 10 10
15 14 11 10 9 11 13 15 16 10 8 9 7 12 11 14 17
11 10 9 10 11 11 11 10 16 13 11 13 11 18 7 11 10
11 9 12 11 19 18 7 20 7 16 16 14 12 7 10 10 22
25 19 14 13 11 32 15 27 29 31 23 12 11 11 18 15 8
11 21 24 8 14 11 12 11 17 7 12 8 11 17 17 21 7
16 7 7 9 7 6 6 9 9 7 6 6 10 6 6 5 8
6 9 9 7 6 9 9 9 9 7 11 6 8 5 8 9 6
5 6 6 11 17 9 5 9 7 8 8 7 24 7 10 16 9
11 14 11 7 12 11 10 11 12 16 11 8 11 6 11 13 20
12 6 12 16 14 16 17 11 10 10 10 15 8 11 6 9 10
15 9 10 16 23 14 14 13 7 9 8 11 16 14 6 5 6
12 30 33 10 31 9 22 20 14 8 10 6 10 6 10 8 15
15 6 10 10 11 15 19 8 8 10 9 10 7 12 6 11 8
11 12 21 17 11 11 11 20 23 44 30 13 9 8 12 8 12
11 8 7 10 14 13 7 11 7 19 10 11 14 11 13 11 16
11 15 27 11 11 9 6 7 10 10 23 13 10 9 10 16 21
17 16 10 16 14 18 11 26 19 13 18 13 16 12 6 6 11
9 7 10 11 14 6 13 10 7 12 10 6 11 16 8 15 14
12 11 10 8 12 18 9 15 11 25 21 20 20 7 7 25 10
11 18 16 13 13 14 20 17 8 11 13 14 12 13 9 10 10
16 14 15 12 8 6 6 11 7 6 9 11 6 5 6 6 7
7 5 9 9 9 6 6 10 9 9 10 24 19 17 21 1 1
1 16 21 16 21 20 16 20 11