S03036-01_I21
Seqid S03036-01_I21
Sequence >S03036-01_I21.phd
NNNNNNNNNNNTNNNNNNNNANNNNNANGGCGANTGGCGGCCAATCGGCCGATTGATATC
TTCTTCATGTTTGTCATTTTATTAGAAACTTTACTATTGGAAATAGCGAATCAACAACAG
CTAACGAACGACTAGGTCTCTAAGAGAAAAAATCTTTTTCTTTTCACAACATGGAGCAAA
TATTATATAATCAAAGCCTTAAAATTTCTACCCTTTCTACTTTTCAAGGTTTAAAGTTTC
TAAAGGTCCTCATTTTTTCTATTTTCCAACAACTTTTTTATAACCCAGTTATACAATTAT
TCGGAACGAAAGCCTCAATAATGGAATCTGATTCCACTACTCTGCTCGAAAGTAGTTGGA
GTACTGAGCGAAACTTTCTCAATATGAATCCAGATTCCATATCTGCTAGCAAGAATGTTT
TTATATTATTTTTTACCATTTTCAGATTAGCGGAGTATATTGTATACAAACTCTCTGACC
AGAAGTATCGGTTACACACATCCCTGAATGTCCAACATTTCAGGTGGAATTCGAAGAAGA
ATACAAACAGAAAAAGGACACTTTCCTTTAGCAAAGCTTACTTACCCANCACNCATATAC
TACNGAGNTGTGTAGGCGATGGACTAAAANTNGATTCTCANGCCCGCTACCTGGAAGTCC
TGGGAAGCTTCCCGAAACTAAATTTATGAGCNAAANAATATTAANCNCCNNNCCNCCCCG
CACNCAANGAGGNANNNANNGTTATGGCAANACAATTATCATTACGGGCCGCATATAATA
CAAATTGAANTCANCNCTCACCCTCTCACNNCGACGTTGTG
Quality >S03036-01_I21.phd
4 3 3 3 3 5 3 4 4 2 4 12 3 2 2 3 4
3 3 7 9 5 4 2 4 7 12 7 13 23 14 28 19 6
26 30 11 10 30 24 10 14 26 30 35 27 36 26 25 25 25
24 12 30 30 16 23 25 25 43 41 41 42 42 42 17 16 41
42 40 34 41 46 33 20 29 31 42 42 27 35 22 18 23 40
30 42 36 33 40 35 28 30 36 31 35 41 42 52 36 22 15
21 35 29 40 37 37 29 39 36 49 40 40 49 41 49 47 43
49 51 34 41 41 40 39 41 45 46 46 37 29 43 42 35 40
49 51 51 52 43 49 49 42 35 29 53 37 23 41 37 31 27
49 51 53 53 53 51 52 49 51 51 49 42 41 52 42 49 50
47 52 52 50 44 50 49 49 49 52 52 49 43 50 49 49 49
49 45 43 46 57 46 57 57 57 53 53 43 45 49 49 49 49
47 49 46 46 40 42 45 42 43 43 43 45 49 43 46 50 54
51 46 46 47 37 41 46 46 39 46 44 54 49 46 49 49 51
51 57 50 49 57 57 53 43 49 50 53 49 46 46 49 57 57
53 53 53 46 45 49 50 51 60 47 49 44 42 50 50 49 58
63 63 63 63 63 63 47 49 47 47 60 49 60 50 50 50 63
63 60 60 60 60 54 51 47 63 60 50 57 51 60 47 47 60
54 60 58 63 60 60 60 63 51 57 60 63 50 63 63 49 63
60 63 63 47 63 59 63 52 44 51 49 51 44 50 47 43 43
34 47 34 29 34 47 58 60 44 34 41 60 60 49 49 42 43
46 63 49 60 49 50 44 60 63 52 54 58 54 58 49 50 50
60 63 63 60 50 50 60 47 49 60 47 49 51 60 49 60 51
42 49 63 39 58 60 54 44 47 59 59 60 60 57 42 44 54
44 59 34 50 50 50 49 43 54 39 51 51 51 47 42 42 42
44 43 44 35 53 53 53 53 46 39 42 50 42 54 49 46 49
38 44 42 50 39 46 50 42 50 50 54 51 20 49 43 42 50
43 40 40 29 35 42 37 43 19 40 39 49 39 50 42 50 43
43 42 26 39 39 39 42 39 39 43 46 42 50 50 51 35 46
46 50 35 50 43 50 36 49 30 43 37 46 35 46 46 43 35
35 35 35 21 54 41 38 38 49 51 43 37 30 49 24 49 35
21 42 30 49 35 35 35 43 29 35 31 29 41 35 31 26 35
12 17 46 41 16 27 46 49 43 46 46 36 46 33 35 41 49
49 46 43 31 37 33 52 41 30 17 18 18 42 41 27 30 34
41 30 29 28 33 15 18 27 17 15 7 8 13 30 7 10 16
30 27 34 9 28 20 16 9 6 15 23 11 6 9 9 11 46
9 9 11 11 12 13 27 10 22 21 29 13 26 9 21 16 21
5 10 7 9 13 10 28 19 19 28 30 7 30 18 29 33 21
32 26 15 19 19 14 30 19 13 26 10 16 15 13 15 16 12
9 17 16 31 24 17 21 19 18 11 18 30 30 31 27 36 9
15 27 35 29 17 14 31 12 13 12 9 6 12 12 15 6 10
38 11 10 14 11 14 12 7 12 6 9 10 6 6 7 9 15
7 10 21 31 8 8 10 8 9 7 12 8 13 6 9 9 11
8 5 12 6 6 6 9 7 7 11 13 15 14 14 13 10 10
10 10 7 12 13 13 14 20 19 12 14 8 16 11 11 12 8
11 22 14 13 18 17 16 15 9 12 15 15 11 19 12 19 20
18 18 14 19 21 13 18 7 14 9 12 7 11 7 11 17 14
8 22 13 11 9 10 11 11 12 8 7 7 11 17 16 11 12
14 11 15 13 13