S03036-01_I22
Seqid S03036-01_I22
Sequence >S03036-01_I22.phd
NNNNNNNNNNNNNNGGGCNNGNGGNNNNNGGCGATTGGCGGCCAAATCGGCCGAATTGAT
CATCAAACAAGCAACTACAAAAAAGCTTTACTGACAACTCACACAAATAACACAAAAAAC
AAAAACTTCAACAATGGTCGCCTTTTTAGAACTAACTTCTGACGTTTCTCAACCTTTTGT
CATCCCATCTCTTTCGCCAGTCTCTCAGCCAAGCTCAAGAAAGAACTCTGACGCAAACGT
CGATGACCTGAATCTGGCTATTGCCAATGCCGCTCTTTTGGATGCCTCTGCTTCAAGCCG
CTCACACTCCAGAAAAAACTCTTTGTCTCTGTTGTAAGTGTTGTACACGAGAATTAACAC
ACTATTAGCATAAAAGACATTTGGCATCTTTACTTACTTGGGCAAGTAAGTCACGTACTT
TTTTTTTTTTTTCCGGAGCATTCATTGTCATTCTATCTGCACTTTCCCGCACTTACATTC
AATAACCTCGGATCGGGTCTCTTCTACGACAGANACTTTTTGATATATACATATTTATGC
AATATAAATACTGAGAAAGTAAAAANANTTAAAATATAACATNATNNNCNNNCCACNNNN
GGGNNGGGNNNGGGNNGNANANNANATNTNGTNCNNNNCANNGGNNNNGCNNNGTATNCN
TAGTGTNANNNAAATANCTNGNNGAATCATNNNATCGCTGCTNCCNGNGTNAANNNGNGN
CGNTNANANTCNCAGANNNNNGAGCNGNAANCATANNANANNNNNGGGAGNNNAATNNNG
ANNNANNNNNTTNNTNNTNTNNNNTCCNNNNNGTTNCGNNNGNNAAGCNGGNNGNCGNAT
GATTANAGNANNNACANNGGTAGGGNAN
Quality >S03036-01_I22.phd
5 3 3 2 3 2 3 3 3 3 4 5 5 5 9 9 10
9 6 6 8 5 9 9 5 5 7 7 7 14 26 9 15 23
15 20 24 14 12 31 24 12 18 12 13 19 30 28 28 25 27
24 30 22 13 26 33 29 13 29 31 33 36 31 20 31 35 31
26 29 31 35 36 36 31 33 32 41 20 35 46 42 35 36 31
32 34 34 31 42 42 37 49 42 41 28 32 40 46 43 35 33
30 31 28 27 25 21 25 35 41 41 36 32 33 35 35 33 36
37 41 35 46 46 46 49 54 54 42 41 43 43 47 49 43 47
42 38 59 38 42 40 46 59 54 54 30 42 54 59 49 32 42
42 46 46 49 49 54 54 46 30 30 35 54 54 49 50 51 50
50 59 59 54 54 49 49 46 43 40 42 35 49 54 54 50 42
54 49 54 54 59 49 45 49 43 52 43 47 51 51 51 51 52
51 46 43 41 54 42 30 46 46 49 47 46 35 33 40 47 40
46 46 49 35 42 35 35 35 37 31 25 35 37 35 32 43 46
42 39 42 35 38 46 40 42 38 46 50 54 52 54 54 54 49
49 47 42 50 39 50 49 50 34 35 32 49 49 49 47 49 50
50 49 54 49 49 49 49 57 50 50 31 43 30 49 54 54 54
54 49 51 51 46 37 50 49 49 46 42 42 49 43 54 54 49
46 54 54 46 46 35 53 43 53 53 53 45 28 43 46 37 54
54 49 46 49 46 49 49 54 43 46 54 32 35 35 35 36 35
35 29 41 32 28 46 32 49 35 49 32 32 32 27 31 32 35
35 35 35 37 40 46 54 49 49 49 54 54 59 54 49 46 43
49 52 52 40 50 50 52 49 49 47 46 49 49 49 49 49 50
37 49 49 49 49 46 49 49 49 49 41 43 46 49 49 50 43
43 49 52 52 37 47 49 50 52 49 49 49 51 51 51 51 43
43 46 46 49 49 49 35 33 27 43 46 46 35 35 35 35 33
26 35 46 49 46 33 33 34 49 49 49 36 42 42 46 26 42
49 16 49 30 35 33 18 18 30 27 37 28 38 36 34 34 32
24 28 25 28 28 34 31 36 32 33 25 25 32 29 46 41 17
36 32 46 49 36 32 34 26 40 51 25 27 26 28 28 46 21
26 31 9 3 11 21 28 42 46 32 23 26 26 12 35 17 26
25 30 30 25 35 35 30 25 32 35 36 49 25 16 35 33 30
39 15 22 25 33 26 31 46 32 27 26 8 14 17 17 21 27
35 34 21 10 3 9 3 9 20 13 21 33 28 25 25 28 10
17 9 12 13 6 10 9 7 5 7 9 6 5 5 9 9 8
10 7 5 5 5 9 11 13 7 7 8 9 9 5 3 3 11
24 10 7 5 8 6 9 7 9 7 7 8 6 13 8 5 8
5 8 18 6 14 7 5 3 3 10 10 5 6 8 13 5 5
3 7 8 15 7 4 3 13 15 11 14 7 8 5 8 19 17
10 17 10 6 9 6 7 7 13 24 10 9 12 6 9 9 5
8 5 6 15 10 15 8 14 14 10 7 5 7 9 21 10 9
13 9 15 9 14 7 15 12 7 15 6 15 9 7 14 11 3
5 6 8 6 8 6 9 9 5 8 5 10 6 10 5 18 9
7 13 16 11 22 7 6 6 5 7 9 29 16 20 7 17 5
12 22 6 11 10 10 8 6 7 9 7 8 7 7 6 5 5
13 15 9 9 9 6 5 7 19 15 8 3 5 5 14 9 7
6 6 15 6 6 5 5 5 9 8 5 5 10 5 6 15 7
15 6 6 5 5 8 9 12 5 5 3 5 6 8 8 12 5
9 8 6 7 6 8 5 5 13 8 8 8 6 23 10 7 5
21 5 12 16 6 10 15 9 9 10 15 10 6 10 26 6 9
5 7 5 10 8 14 3 5 9 13 12 10 12 13 8 6 18
6