S03036-01_I24
Seqid S03036-01_I24
Sequence >S03036-01_I24.phd
GNNNNNNNNNNNTNNNTNGNNNCNNNNNNGGGCGATTGGCGGCCANTCGGCCGAATTGAT
CTAACATAAATATATAAACGCAAACAATGGCCAGAACAAAGCAAACAGCAAGAAAGTCCA
CTGGTGGTAAGGCCCCAAGAAAGCAATTAGCTTCTAAGGCTGCCAGAAAATCCGCCCCAT
CTACCGGTGGTGTTAAGAAGCCTCACAGATATAAGCCAGGTACTGTTGCTTTGAGAGAAA
TCAGAAGATTCCAAAAATCTACTGAACTGTTGATCAGAAAGTTGCCTTTCCAAAGATTGG
TCAGAGAAATCGCTCAAGATTTCAAGACCGACTTGAGATTTCAATCTTCTGCCATCGGTG
CCTTGCAAGAATCTGTCGAAGCCTACTTAGTCTCTTTATTTGAAGACACCAACTTGGCTG
CCATTCACGCCAAGCGTGTCACTATCCAAAAGAAGGATATCAAGTTGGCTAGAAGATTAA
GAGGTGAAAGATCATAGTTTGTTGATTGTCATCAGTTTTAGTCAAAAACGAACAAAAACA
CAATAAAATATAAATCAATATATTTAGGTTTACTGGGGTTCNTTAACAGTTGNNANTAGT
TATTTTTTATCAGAAGNNTAAGTGGNATTNNTTANTATTATCGAAAATGAGAACAGNNNA
AGAAANGAGGGGGTAAGAANNATGTNTNNGGCAAAGTNNNGGTTGAAANCAAAGGCAAGA
AACCACGGGCCGAGGTGAGGNAAAGGGNGGAGGGANNCATGNTTAAGTTGAATNAAAATG
TTAAGGCNACCGGGCGAACTCGANGTCNTNTGAGGGAGATGGNAAATGAGGCCANGANCG
N
Quality >S03036-01_I24.phd
9 6 4 3 3 2 3 3 3 3 6 5 8 6 6 5 9
7 8 5 5 6 10 5 7 5 5 6 5 8 12 14 11 29
27 18 29 27 12 12 21 21 13 17 8 5 23 31 26 19 25
28 21 25 13 24 28 26 9 21 26 43 31 27 31 27 31 22
27 29 38 28 29 35 40 44 37 34 42 33 41 28 29 35 30
14 17 28 32 21 32 35 29 33 41 22 35 13 25 28 32 40
35 33 41 43 32 32 30 29 26 35 33 33 35 35 39 35 35
33 38 38 43 50 49 49 50 46 39 50 50 45 44 54 50 50
42 50 50 54 54 54 43 54 42 43 44 50 50 50 54 54 46
53 50 49 49 47 57 50 51 53 53 50 50 52 54 54 49 46
50 49 49 44 50 54 50 50 44 49 53 50 49 50 54 50 49
50 50 49 49 60 63 45 50 51 47 63 60 49 51 47 49 54
54 60 49 50 45 60 60 60 49 60 47 60 50 49 50 60 47
47 50 50 54 60 49 60 51 49 60 49 50 50 50 58 47 49
60 47 47 60 40 42 49 49 50 45 38 50 49 50 49 57 60
57 54 52 63 52 60 54 57 57 52 60 52 60 63 57 52 58
52 52 57 52 57 63 63 60 49 50 60 58 47 63 63 63 45
63 50 44 50 49 49 45 42 60 63 51 49 51 50 60 63 50
49 54 50 50 52 50 50 54 54 54 54 49 45 42 60 51 50
47 49 60 57 50 60 54 51 49 57 57 52 44 47 42 35 49
60 47 39 47 49 49 47 49 60 49 50 42 45 42 49 60 47
43 47 49 42 60 43 49 50 49 43 44 49 63 49 50 60 49
63 50 54 50 60 63 44 54 60 49 49 50 60 51 60 50 54
60 60 60 60 60 47 47 47 60 60 57 54 58 49 50 50 60
54 54 42 58 60 60 58 63 46 60 60 50 60 50 60 49 58
49 60 60 54 50 44 43 58 49 57 58 63 58 57 54 47 50
50 50 54 54 47 42 49 63 63 47 63 43 42 63 34 28 47
49 60 33 33 46 38 41 34 41 32 47 47 47 47 60 40 33
19 40 39 35 46 57 46 58 28 57 42 40 43 57 52 39 57
42 57 57 57 44 43 43 57 47 57 57 52 42 43 43 35 57
47 52 47 35 26 35 41 22 57 46 52 43 43 44 59 57 52
47 42 42 41 41 60 48 44 52 46 42 40 35 44 39 40 60
40 35 37 60 46 47 60 52 33 40 40 44 31 42 52 34 35
35 34 60 47 42 37 24 22 41 16 12 18 19 35 21 23 14
27 29 15 7 24 27 18 16 18 12 9 12 25 17 6 6 8
5 10 10 20 26 22 12 15 18 13 18 22 22 18 10 8 8
8 9 11 8 7 6 8 17 8 9 10 9 8 6 11 9 12
7 7 9 11 12 7 10 9 9 11 9 8 8 9 9 10 15
13 10 11 12 11 12 15 11 17 9 6 6 7 19 10 15 24
18 17 6 10 23 10 9 12 13 19 12 25 18 12 19 13 7
6 9 15 11 20 7 11 6 6 10 10 13 12 18 10 16 8
6 6 6 9 9 9 9 10 9 18 20 6 11 10 12 12 8
10 9 8 10 9 10 9 12 10 8 13 12 22 11 10 9 9
19 11 10 10 11 14 10 11 12 6 8 9 11 14 16 11 7
10 11 10 15 14 13 10 6 7 10 15 19 11 6 19 11 12
14 9 9 14 12 16 21 12 6 9 11 9 13 11 11 9 9
11 11 9 11 10 7 21 14 11 10 12 8 10 13 8 10 10
9 10 11 9 6 9 10 9 7 8 6 9 10 9 9 10 12
19 22 10 11 12 9 6 9 14 10 10 10 10 10 14 10 9
9 6 10 9 6 13 9 6