S03036-01_J03
Seqid S03036-01_J03
Sequence >S03036-01_J03.phd
GNNNNNNNNNTNNNNNAGGNCNNNNNNNNNGNNGATTGNGCGGCCAAATCGGCCGAATTG
AGCCCACAACCGATTCATAAAATGTCTGCCTGGAGGAAAGCTGGTATATCATATGCTGCA
TATTTGAATGTGGCCGCTCAGGCTATCCGTTCTTCATTGAAAACTGAATTACAAACCGCT
AGTGTTCTTAACAGATCGCAAACAGATGCTTTTTATACCCAATATAAAAATGGCACTGCA
GCTTCTGAACCCACTCCAATAACAAAATAGTTAAACGCTTCCTGGGAACTGCAGCTCTTT
TTTTACTCGCTGATATACATTTTAAATATTCTAGCAACTGTGTATGAAAACTTACGTACT
TTTATACGGGAAACTAATAATGACTACNNAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAANGTANCNGCCATAAGGGCCAGCTTGAGTATTCTATAGTGTCAC
CTAAATAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAAATGTTATCCGCTC
ACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAAGCCTGGGGTGCCTAATG
ANTGAGCTAACTCACATTNANTGCGGTTGCGCTCACTGCCCGCTTTCCANTNGGGAAAAC
TTGTCGTGCCCAGCTGCATTNATGGAATCGGCCAACCNCGCGGGGANANGGCGGNTTGNG
TAATGGGGCGCTACGTTTGNGGTGCTGGTAATCTTTATTANCTCACCTNAAAAGCGGGAA
ANNCGGTTTTCTCCNCCGAATTCTNGNGNTAACNCNNGAAAAAAAACATGTGAANAAAAA
GGCCCGCAAACGNGCCGGAGACNGAAAGAAGGCGAGGTTGTTT
Quality >S03036-01_J03.phd
8 3 3 4 6 4 3 3 5 5 9 6 7 6 6 7 13
10 9 6 9 7 5 5 3 3 3 3 5 6 8 5 5 16
22 16 29 28 7 15 11 24 22 14 17 11 11 30 42 29 42
26 30 31 32 25 15 30 37 31 32 30 27 31 21 30 32 31
41 50 42 37 35 32 43 27 37 37 37 49 49 49 28 42 36
40 41 28 42 49 49 49 46 38 32 49 32 35 35 21 35 54
54 43 38 42 40 59 50 38 46 42 54 42 59 59 54 54 42
42 50 54 42 50 50 54 45 45 49 50 50 57 44 42 49 47
45 45 43 47 44 57 47 44 47 60 50 49 50 54 54 59 60
59 52 52 57 60 60 52 43 43 63 46 63 52 58 57 57 52
60 57 47 57 60 60 57 57 57 52 60 52 58 60 60 63 52
57 57 40 53 35 52 42 63 42 57 52 60 57 63 63 47 43
40 53 35 48 52 57 60 60 60 52 46 47 46 60 63 53 32
58 52 52 57 46 60 60 60 60 57 60 63 41 43 32 43 60
41 43 40 40 48 48 43 57 60 52 53 37 63 63 37 52 52
47 57 41 52 35 47 57 46 31 52 60 60 40 46 46 60 63
41 63 53 40 40 57 52 63 30 53 52 60 60 43 41 41 34
60 46 42 34 46 57 44 34 52 63 63 63 63 63 43 26 35
42 35 42 47 44 42 47 24 42 42 35 44 31 42 53 43 47
42 53 53 27 42 27 51 39 39 43 31 50 24 47 43 30 43
39 42 39 42 38 42 42 49 49 54 54 32 49 35 46 35 54
43 43 35 49 45 47 46 43 49 46 30 53 44 33 52 52 33
47 41 53 42 46 50 49 49 49 46 51 32 10 3 6 19 21
32 17 28 28 22 32 40 36 40 45 49 49 49 49 45 51 51
51 45 40 49 46 46 49 46 34 35 37 34 37 34 38 38 40
36 37 41 40 38 16 25 23 17 14 23 25 7 27 15 9 7
15 7 9 25 36 17 24 31 50 16 41 45 26 47 31 17 38
35 31 11 22 16 30 24 23 36 19 20 23 16 24 18 23 31
21 22 24 30 40 21 22 48 42 17 20 21 28 30 30 16 36
17 37 18 35 37 15 31 29 28 31 43 18 35 24 19 30 20
31 40 27 30 52 48 16 31 27 27 14 21 28 20 33 52 27
11 23 19 9 36 35 23 20 31 15 16 27 18 22 16 20 32
19 32 13 25 17 23 19 23 20 38 23 24 26 26 21 25 44
13 31 29 15 42 34 39 16 31 18 27 20 52 30 17 22 29
16 21 52 52 28 14 16 37 29 29 37 42 45 17 29 10 30
21 28 37 17 17 21 7 28 28 33 11 25 10 15 31 22 19
14 13 14 20 14 8 7 10 7 12 26 10 10 16 9 19 17
11 10 8 22 14 12 16 27 28 11 37 20 10 9 17 43 22
9 11 9 5 8 7 14 45 30 39 52 22 11 12 12 8 19
26 30 19 15 22 11 13 11 16 18 21 27 25 19 31 20 11
7 9 13 11 8 25 9 8 10 12 17 33 23 13 23 11 12
7 16 8 22 17 35 40 33 9 6 10 5 11 15 10 18 17
6 23 28 14 7 9 9 15 9 20 18 17 20 28 19 28 16
9 9 13 9 20 18 11 9 7 16 8 17 12 8 11 22 14
8 14 16 11 11 15 10 12 11 15 9 12 7 11 12 14 15
12 11 12 7 29 31 35 20 30 15 27 18 18 16 31 12 7
7 9 9 20 12 14 16 12 11 14 27 22 7 21 16 16 21
28 16 19 13 9 7 17 7 15 6 8 15 28 14 7 9 6
6 10 11 19 22 21 12 34 38 30 14 28 28 16 16 12 28
25 6 15 23 37 41 28 20 16 27 28 12 12 32 22 17 17
9 9 7 10 21 17 28 19 14 11 9 13 6 10 21 24 10
8 16 12 17 14 9 8 8 16 21 16 18 11 8 11 12