S03036-01_A23
Seqid S03036-01_A23
Sequence >S03036-01_A23.phd
NNNNNNNNNNNNNNTNNNNNNCNANNANTANNGCGATTGGCGGCCAATCGGCCGAATTTG
TGGAGGCTTGCTAGTATAGAATGGCAGTAGAAGAGGGTGGTTGCGTGACGAAACGTTTAC
AAAATGAGCTGCTACAGCTACTTAGTTCTACAACAGAAAGTATTAGTGCTTTTCCCGTAG
ACGATAATGATTTAACATATTGGGTAGGGTATATTACAGGCCCTAAAGACACACCGTATA
GTGGACTTAAATTCAAGGTTTCATTGAAGTTTCCTCAAAACTATCCTTTCCATCCGCCAA
TGATTAAATTTTTGAGTCCAATGTGGCATCCAAACGTGGATAAGAGTGGCAACATTTGTT
TGGACATTCTGAAAGAGAAATGGTCTGCAGTGTATAATGTAGAAACAATTCTATTGTCAT
TGCAGTCATTACTTGGCGAACCAAATAACAGATCTCCGCTGAACANNCTGGCANCCCAAC
TTTGNNATGCGGATGTGGAGGAATACTGANTANNTCNCTGACCTGTTTAGAAGAAATCNG
CGANNACTGAGTTNACCCAAAATNGGCGAAAANATGATAAAACTAAAANGCNCCGACTCT
CACANGNGGNGGGNGAGGGGGGGCCGCGGNTTNACTAGNANNNANTAAGNNCANNAGGGA
AGTGGAAAAGCTCGTTTCNNGTNGTGTGTTNNGNANAAAANAANAACAAANNCNANACCC
CNTGCNNNANAGGGANNNGGNNNNNGNNAANTNGTNGGGACTANATATANAAAAAGGANG
GANNAAGNAGGGNNGNNNNTACTAGCNTGGTAANNGGNANANNGGNNNNACNCGCATGCC
CCNGNNANCAGANNNNT
Quality >S03036-01_A23.phd
6 4 2 2 2 3 3 2 3 3 2 4 2 6 12 6 4
6 5 5 5 10 5 8 6 7 10 6 9 11 5 5 8 13
12 14 16 25 19 10 13 32 18 12 19 13 15 30 33 31 24
13 18 13 16 12 17 24 23 11 23 21 16 25 32 23 27 40
29 28 17 21 11 34 28 30 23 47 21 20 30 20 40 17 24
21 17 23 36 19 29 30 12 26 13 19 16 15 18 14 20 25
32 28 28 32 31 19 27 30 38 37 32 42 41 41 41 28 32
34 21 30 29 36 38 46 32 36 42 46 36 32 35 27 52 35
35 46 42 33 41 37 30 32 17 32 50 30 43 43 46 27 49
50 40 50 42 46 46 49 49 49 50 50 49 53 46 51 49 54
49 49 50 54 54 49 49 43 46 38 35 35 46 51 46 54 57
49 53 39 38 53 51 49 53 49 46 51 49 51 49 50 49 49
46 49 50 51 51 46 50 38 54 50 50 49 54 31 50 50 54
57 42 42 42 42 39 43 39 40 35 40 37 42 43 46 32 39
39 29 42 31 57 40 33 29 50 50 59 54 51 49 53 47 43
49 49 57 54 53 49 49 43 44 53 54 57 57 49 51 45 45
49 51 50 50 42 47 49 46 49 50 49 51 54 57 54 57 51
50 49 39 57 54 57 54 54 50 46 46 49 50 44 44 49 46
46 46 46 53 53 47 43 53 49 46 49 46 45 35 53 50 53
49 51 51 50 50 49 49 45 36 54 46 43 39 46 49 35 39
42 35 32 26 38 29 32 36 26 43 22 39 44 22 32 36 33
29 29 35 37 25 21 33 47 44 54 54 60 47 44 42 41 41
47 50 44 47 47 47 42 42 35 35 60 47 47 39 35 32 47
60 50 47 34 25 34 27 63 44 45 14 42 37 33 47 33 44
42 60 47 47 40 37 43 37 19 42 35 44 47 42 28 14 9
17 38 44 42 38 35 42 42 38 40 39 28 42 33 20 19 47
26 20 24 24 42 42 39 44 28 47 22 24 27 28 42 24 39
42 11 21 14 9 9 5 5 8 9 14 23 24 9 7 18 10
13 15 12 16 16 15 16 10 5 5 19 15 14 13 9 15 42
27 13 20 24 35 21 14 22 23 16 23 21 21 9 14 10 6
12 9 7 7 9 9 7 22 23 16 11 8 10 28 12 9 11
10 9 8 14 19 9 9 15 16 16 9 7 9 11 9 11 6
6 13 16 13 10 16 9 10 9 6 10 16 17 10 9 11 11
9 10 6 12 13 9 12 11 9 10 22 6 20 16 35 16 11
9 9 11 14 11 9 15 16 12 8 7 9 9 7 18 10 9
9 10 9 18 9 8 9 8 9 7 8 7 9 9 7 14 14
11 6 9 12 16 25 33 11 18 11 9 13 10 11 9 14 9
7 9 29 6 9 10 10 10 8 7 8 7 7 6 11 7 10
8 15 9 6 6 9 9 7 7 9 9 9 9 15 9 14 9
11 18 15 10 9 12 9 9 9 10 9 9 9 13 10 7 6
8 9 7 13 11 9 8 11 10 9 6 6 9 6 23 6 33
9 14 10 7 16 9 6 12 11 12 9 9 12 6 6 9 6
8 6 8 14 12 23 9 7 9 8 22 6 7 7 9 6 9
11 21 11 8 7 5 5 9 14 5 6 6 7 6 10 7 6
8 10 7 9 6 8 13 7 8 9 8 9 8 9 9 6 9
11 9 8 15 7 10 9 9 9 9 9 11 9 6 9 9 8
6 7 11 9 22 6 8 15 9 16 6 7 12 6 5 5 6
9 9 14 9 9 16 10 7 9 13 8 8 10 18 7 6 9
10 7 12 6 10 6 6 8 8 6 7 6 7 18 9 7 10
9 10 9 9 8 17 9 10 8 7 8 6 6 14 7 9 8
10 9 6 6 6 7 9