S03036-01_J05
Seqid S03036-01_J05
Sequence >S03036-01_J05.phd
TNNNNNNNNNNTNTNNAGNNNNANNNNNGGGCGATTGGCGGCCAATCGGCCGAATTTAAT
ATTTATTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGTACCGGCCATAAGGGCC
AGCTTGAGTATTCTATAGTGTCACCTAAATAGCTTGGCGTAATCATGGTCATAGCTGTTT
CCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAG
TGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTG
CCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCG
GGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGC
TCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCC
ACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGG
AACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGNTCCGCCCCCCTGACGAGCAT
CACAAAAATCGACGCTCAAGTCAGNNGTGGCGAAACCCGACAGGACTATAAAGATACCAG
GCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTTCGACCCTGCCNNTTACCAGA
TACCTTGNNCCGCCTCTCTCTCTCTCGGGAGNGGGGCGCGTGTCTCAAAGCTTCACCCCT
GTAAGTTTNTCCATTTTCNNANAAGTCGATCGCTCCACAGCTGGNNTGTTGTGGCCANAA
ACCCCCGGTAAAACCAGAACACTNANNNTTATNCGGGAAANTATTTTGCTTNGAGGCGAN
GCGGGAGAGAACGACATNTTGC
Quality >S03036-01_J05.phd
9 6 3 3 2 3 2 5 6 3 3 12 5 8 7 5 9
10 3 3 5 3 10 5 5 3 3 5 13 26 26 9 23 32
15 42 32 13 15 36 21 15 18 20 15 32 31 36 24 35 41
40 25 21 35 47 26 15 23 27 30 41 41 29 40 42 40 29
9 18 33 39 36 49 50 49 49 49 42 46 46 46 43 35 35
35 34 35 49 49 46 43 46 43 46 43 41 35 35 35 35 31
28 42 35 35 40 35 33 46 42 33 42 42 39 35 46 44 50
50 50 54 50 43 42 44 44 32 33 42 45 42 42 32 42 46
44 42 39 47 42 49 44 47 47 40 47 47 60 47 50 54 54
47 39 43 44 44 44 40 44 60 60 49 37 35 60 60 47 54
54 60 50 60 47 40 38 60 60 42 46 47 40 43 35 47 47
47 49 43 46 50 60 44 47 47 60 49 60 42 35 40 35 40
42 42 50 49 60 49 49 49 27 60 35 32 35 43 33 42 47
44 50 40 43 42 47 49 60 60 47 43 39 60 54 44 59 42
35 27 24 35 44 44 42 35 44 50 42 32 60 63 60 40 31
42 47 47 47 60 43 38 38 35 32 38 43 47 42 50 47 60
60 42 28 35 22 29 32 46 59 50 37 38 44 42 36 32 38
43 39 29 21 28 28 34 28 44 42 50 42 50 46 26 42 42
54 37 27 27 31 42 43 35 42 46 49 42 57 53 26 39 29
35 32 39 29 20 31 26 49 28 35 49 35 35 32 30 37 39
35 49 35 40 43 49 30 46 35 30 36 49 28 54 35 31 34
29 23 34 53 49 43 27 30 41 30 46 21 49 49 35 46 42
39 33 29 43 41 49 46 51 53 52 33 31 50 42 34 46 46
36 50 30 44 49 49 36 41 32 46 34 46 37 32 28 31 46
46 43 32 35 40 32 46 49 49 37 28 31 28 38 35 51 29
49 46 30 52 46 40 46 29 49 46 30 31 52 28 47 43 38
18 49 49 31 32 44 35 41 35 40 44 35 28 31 37 32 29
50 51 31 52 19 37 49 20 25 50 28 34 31 20 51 31 44
21 36 33 41 13 36 21 31 35 40 26 32 21 26 52 52 50
28 14 31 47 36 31 31 31 20 47 21 47 48 16 31 41 24
28 46 29 28 24 33 14 35 18 40 42 40 18 31 9 42 19
30 34 24 42 47 47 16 41 17 48 19 18 48 11 46 18 52
31 37 31 52 52 52 52 23 48 21 46 24 21 29 24 46 23
24 27 27 47 22 30 21 47 47 47 41 13 41 16 31 26 16
41 7 35 16 36 34 27 47 41 41 42 44 30 23 35 12 9
30 15 17 17 16 11 16 24 10 28 41 42 27 29 17 16 26
20 21 30 26 12 11 10 9 15 22 11 8 6 6 11 12 21
27 11 13 23 41 41 16 31 29 21 15 11 24 20 36 25 21
16 11 16 8 34 31 22 26 17 15 22 35 21 11 30 14 9
8 40 35 28 31 43 43 14 10 11 9 18 31 25 19 18 26
47 30 23 26 21 9 19 18 16 17 10 16 31 21 10 12 17
14 18 9 14 31 30 17 28 26 18 15 9 11 6 6 8 16
18 13 15 9 8 11 9 13 9 12 9 10 10 6 6 20 17
8 17 12 13 9 16 15 14 9 9 13 9 8 11 11 11 26
12 17 9 7 8 19 12 20 8 14 11 13 10 8 16 19 16
14 20 8 11 10 10 16 9 20 21 13 12 15 9 25 8 29
17 12 12 12 9 13 7 15 8 11 11 10 17 26 16 11 7
6 8 6 10 15 18 14 13 17 13 24 14 10 12 13 16 28
11 11 29 17 14 17 19 21 7 6 12 11 17 14 16 22 14
9 9 20 9 7 27 13 12 12 22 20 31 21 14 17 22 9
15 19 30 11 9 11 9 24 12 8 8 11 10 7 9 6 6
6 13 10 11 10 6 9 9 13 12 14 11 13 5 9 9 12
17 9 11 13 15 12 18 7 9 8 13 13 16 13 12 7 9
9 17 34 29 13 9 10 8 26 16 9 10 20 8 9 8 6
16 16 8 8