S03036-01_J07
Seqid S03036-01_J07
Sequence >S03036-01_J07.phd
NNNNNNNNNNNGNTTNNCGTCNNNCNANNTGGGCGATTGGCGGCCAAATCGGCCGAATTC
CCATGGGGATCCGATGAAGATCTTTATAAAACATAAAGCAAATCAAAACATAATAACTAC
TACAAGTAACATAATGTGCTCAGCAGGCGGTATCAGAAGACCAATCCAGATCGAAGAATT
TAAGACGGCGATAAGCGGCATGTCCGACATGGAGTTGGCACAGATTAAAACAGAAATTGA
GAACAGTATCAATCATTTGCAGAGGTCTAACGCCCGCTTGGGTAAATACATAGCTAAGTT
GGAGGGTGCTGACGACCGTCTTGAAGCTGACGACAGCGACGACTTGGAGAACATTGATTC
GGGAGACCTGGCGCTGTACAAGGACTCTGTCAGGGAGAACGAANTTGTGCTAAACAATTA
CAATGAGAGAGTGGACGCATTGGAGCAAGAAACGGTATATANNANGACGGGCCATGGCNN
GGGTNAGCACGANGTANAAGCAAATGACNANACCCNCAANGNNCCTGGCGTNATCCTNGG
CAAGTNGTNNGTANAGCCGTTTCTTCAAATCGGNAAATNATGGANGGGTTGGGACGNGGA
ATGAAAAAAAGTNTNAANGAACCGNNANTNCTCAGNCATTGGGCNTGNNNAAGATGTGAN
GTAANANAGAACTAGCGAATAGTANTCTTAACCGNGTCTAGGNNCAANCATNNAGNTGAT
NGGGAGNNGNGAAATACTNNGNGGGGCCTGTTNAGGNTNTTTGGCTNATTNGNTTGACNT
TTAGCGAGATTGATCCTNNAAGTAAAACTGGTGNATGAGAAATNGGTGATTTNCAATAAA
TNGNNGTTATTTACCNTATNTGGACANGTNGTGTGNNTTTTANANATGGNTCCNNGNNNN
NGNNCA
Quality >S03036-01_J07.phd
6 5 6 5 4 5 3 3 4 4 5 14 7 13 9 7 6
14 8 9 8 6 7 5 9 7 9 5 7 8 9 12 23 8
9 22 14 20 26 17 12 14 17 17 18 19 22 14 25 30 17
19 26 29 28 24 12 21 40 24 24 15 23 30 33 40 40 41
15 11 26 24 17 35 30 32 30 28 26 26 20 34 33 33 29
34 36 27 27 28 30 41 28 37 25 26 26 29 32 28 19 35
35 27 17 19 23 27 39 33 42 33 26 46 35 36 46 44 42
50 44 38 38 26 35 28 44 44 47 47 44 50 50 60 46 60
60 51 49 58 58 54 63 63 57 52 58 57 57 58 52 57 57
57 52 60 57 57 57 52 52 52 39 60 57 57 52 52 52 63
57 63 60 52 60 52 52 52 52 60 48 52 52 60 52 52 52
57 60 40 48 57 42 52 47 57 60 52 47 41 57 57 52 57
57 60 52 60 46 60 52 53 48 57 60 60 52 58 60 53 57
53 45 52 52 54 44 48 48 57 57 52 57 57 57 52 52 63
60 57 57 58 63 48 53 52 63 60 57 52 53 63 57 57 36
57 48 43 48 53 45 44 57 33 57 53 52 52 46 57 60 57
54 63 57 57 57 57 60 60 57 57 52 46 63 52 46 46 52
34 60 52 35 60 52 33 57 35 54 52 60 60 52 39 53 53
28 52 41 60 60 46 31 46 52 39 43 48 42 47 57 57 60
24 48 27 47 43 47 44 28 35 44 60 33 47 52 34 42 42
20 35 35 60 57 40 21 41 22 43 41 33 34 40 41 60 52
42 63 35 35 49 50 44 35 44 18 41 41 60 60 47 50 60
46 47 49 42 43 21 20 21 47 33 35 60 47 49 49 42 43
32 15 49 42 44 35 41 19 19 12 21 12 7 8 30 24 27
35 35 27 12 27 42 42 13 42 60 39 24 42 24 25 35 38
27 27 31 24 13 12 16 35 27 35 21 32 47 28 44 42 29
18 29 22 24 9 11 12 11 9 16 19 13 21 16 16 28 12
28 9 6 6 11 6 10 10 11 16 16 10 10 15 25 42 42
26 19 7 6 10 9 9 14 7 10 10 18 14 14 19 21 6
11 16 12 6 18 13 18 12 9 14 16 8 17 19 8 6 13
6 18 24 28 13 7 9 13 10 6 10 6 6 17 19 23 9
11 9 14 9 6 11 8 16 8 9 6 14 10 8 9 16 9
9 6 8 8 6 6 9 15 11 6 11 11 9 9 11 10 11
10 14 9 10 14 9 10 14 8 14 15 11 7 11 18 10 10
6 9 9 10 9 9 6 10 14 10 8 9 8 12 10 11 10
13 7 9 9 10 10 14 11 9 9 9 12 12 11 9 10 9
6 11 7 14 9 6 8 11 11 11 12 10 6 7 9 7 9
6 9 9 11 11 9 7 11 11 9 11 12 11 11 8 6 8
14 6 6 6 8 14 8 9 9 22 10 8 10 6 11 8 10
9 6 9 6 10 9 9 9 10 9 9 9 10 11 9 9 10
13 11 13 19 6 9 9 10 9 9 10 10 10 9 6 9 9
9 14 9 11 9 6 6 11 10 9 6 11 10 9 6 6 9
8 6 10 9 8 9 6 10 9 11 14 11 6 6 8 6 11
8 9 11 9 9 8 9 6 6 10 6 11 11 9 9 9 10
10 9 9 12 6 8 11 11 7 11 5 8 10 8 11 14 8
10 6 8 9 9 6 9 6 10 11 14 9 9 6 11 11 14
11 9 11 9 10 9 11 20 23 9 8 9 10 8 8 6 6
14 14 10 14 10 14 9 8 10 10 11 8 10 8 6 11 10
10 8 9 8 14 14 9 6 9 9 11 10 14 10 10 11 7
9 11 9 11 9 9 9 9 6 8 6 6 11 11 11 9 9
9 8 10 11 11 6 11 14 10 7 8 16 10 11 9 8 6
8 10 6 14 10 8 8 11 7 6 14 9 9 10 10 7 9
7 9 9 10 19 6 9 10 9 7 6 9 7 6 6 6 6
9 6 7 10 8