S03036-01_J08
Seqid S03036-01_J08
Sequence >S03036-01_J08.phd
GGNNTNNNNNGNNCTCNNNCNNNNTTAANNGAAAATNNNTTGCCAANCGGCCTAATTGAT
CAAACATGGGAAAGAAAAATACAAAGGGAAAAGAAAATAATGCTGCTAAAACCTCTTTTC
TAAAAGTAGAGAATATTAAAAACACCAATTCGGGATTGGAGCTTCCATCGCAAGACTATA
CAAACGTTGAAGAAAAAGAAAGTAGCCCGAAAACTGACTTTCCATTAATTACAAAGGAGC
ATGTAAACACGAAAACTGACAGCAATATTCTCGATTATCCCACCATAGGCGATTTAGTTT
CCTCAGTAGAGAAATTATGTGTCTTGAAAGAATTGAAGATAGCATTTCCAGAAGTAGATG
ATACATTGATTAAAGCCATTTTAATTGCCTCCCAAGGGGTATTGGAGCCCGCCTTCGATT
NGGAACGAGCGAAGTGAATCGGANTANAACATCGAACTAGGAGGCGGTTTAAAACCGTGA
ATGTGAGAAAAAAAGNNNAANAAAACAGACCTTNNNTNAGCGGCNAGTGTGGGGGGGGAN
NAAAATNAATATTTNTTTTTCCTCTCTACAAACAAACAAAAAGGGAGGGAGANGGGGNAA
GTNNANTNNAAAGAANCATCCTCTCACCAGGCCTCTTGGGGGGGAGGGGTGGAATTTNTG
GAAGTTTTNGTTAAGCGACTATNACAAACATCCGGAAGGANGGAGCNNGGGNGGAGANNG
CANCCCCCACNGCGGCAGGCNATGCTGGGGGAAGAAGGGGGGTAANTTAAGAGANTTAAA
AACNAACAAAAGAAGATTGAAAAAAAAAACGTAAAACCCCCACCCCGCCCCCCNCAGAAA
NCNNNGGNNNNGGGANTGNTTGAGTNTNGAAANAGAANAGNTNAAGAATTTANGCAAATG
AACCCCTC
Quality >S03036-01_J08.phd
19 16 6 5 8 5 7 7 7 7 9 5 5 8 10 9 7
7 7 8 5 7 5 7 9 9 12 9 5 5 11 9 9 8
9 8 5 7 7 9 9 8 11 12 9 10 7 15 11 12 12
11 8 14 19 18 41 37 20 10 26 29 53 27 32 16 41 42
22 22 32 36 34 20 24 13 9 13 10 19 10 9 16 13 9
10 24 18 20 24 28 29 24 38 25 23 29 28 14 10 14 20
13 14 24 38 16 26 29 19 21 38 24 28 35 40 53 46 53
40 53 31 42 50 47 38 46 35 32 53 42 52 57 60 60 52
53 53 53 53 53 53 53 53 53 52 57 57 60 53 53 53 53
53 50 48 53 43 53 53 46 53 53 53 53 53 38 46 53 53
53 53 44 37 50 50 32 27 40 38 42 38 44 47 44 26 26
29 18 24 34 13 37 24 34 29 20 24 31 14 20 33 32 38
35 38 35 33 41 53 40 24 33 39 32 35 28 37 53 53 53
42 37 39 53 53 45 53 53 53 60 57 53 57 57 60 63 63
52 57 53 57 57 52 52 60 57 60 53 46 25 46 53 53 52
52 58 53 41 53 53 53 53 53 46 53 53 38 53 53 60 53
53 52 53 52 57 52 60 53 41 53 52 53 42 53 38 17 30
27 23 37 37 45 38 27 27 35 31 23 37 53 44 46 42 42
23 27 28 42 23 19 19 27 19 16 19 19 30 53 46 27 35
27 29 53 33 35 33 42 53 42 37 53 53 42 40 24 53 53
45 45 53 53 52 53 46 46 53 45 44 46 35 30 53 37 39
53 53 42 37 26 37 53 24 31 46 42 27 42 53 28 53 37
40 46 37 19 44 53 53 37 27 38 33 42 42 45 53 47 35
42 42 38 33 14 23 14 23 14 9 10 13 11 8 14 11 19
27 11 14 14 11 22 20 14 9 10 10 12 6 10 13 10 14
9 14 10 11 9 10 9 11 11 10 9 8 8 11 14 11 15
18 7 9 9 6 8 10 14 11 11 10 9 18 9 10 9 9
9 11 15 10 11 10 9 13 10 13 9 17 17 18 19 15 12
11 13 12 9 11 14 9 9 9 14 15 9 9 14 13 14 11
20 9 6 6 6 9 10 7 10 14 19 11 10 16 9 10 8
8 10 11 6 6 6 9 6 14 11 11 24 12 16 6 9 9
11 18 11 16 13 10 13 26 24 9 10 10 6 6 16 12 16
10 11 6 9 9 12 14 11 10 16 6 16 24 19 11 10 10
10 11 11 10 9 9 14 10 10 16 11 11 14 32 13 9 13
15 12 14 20 22 11 13 9 12 11 9 8 8 8 6 11 16
13 10 7 11 13 14 9 6 6 8 5 8 6 6 14 11 26
12 12 10 6 9 13 11 11 10 11 14 9 12 10 9 10 11
13 15 12 10 10 10 9 11 20 17 13 11 11 8 9 9 9
14 14 12 10 9 10 11 9 9 12 8 6 9 8 11 9 10
9 10 14 10 11 6 11 9 23 11 12 11 10 19 26 10 8
11 10 7 9 10 9 11 15 14 22 11 11 9 13 15 8 10
14 9 10 6 19 16 8 9 11 6 6 10 9 9 6 10 9
9 13 9 6 6 11 9 11 6 13 10 9 9 9 11 13 6
10 14 13 14 13 9 11 11 10 7 15 12 14 11 10 10 10
14 11 9 10 10 14 9 11 19 8 12 10 9 9 10 28 9
6 10 10 10 11 10 10 13 9 7 9 10 10 16 10 22 12
8 6 11 11 12 12 11 13 30 14 11 11 9 9 10 10 13
14 10 10 11 11 18 9 18 18 13 9 11 9 10 11 13 9
9 11 10 11 13 11 9 10 9 9 10 9 11 15 30 11 9
6 9 14 12 13 10 9 6 9 6 6 6 11 20 6 6 6
7 9 12 9 9 6 11 14 6 9 11 19 9 11 8 6 8
6 9 12 9 9 6 14 14 24 44 6 14 8 6 11 6 10
9 11 11 13 11 13 11 11 6 10 10 13 11 11 10 10 16
9 9 9 9 10 8 11