S03036-01_J09
Seqid S03036-01_J09
Sequence >S03036-01_J09.phd
NNTTNNNNNTTNNNNNNNANGNCNNANGGNGATTGGCGGCCAATCGGCCGAATTGATGAA
TGTGCCCAGTGTAAAGATCAGAAACATGCCAAAGGTAAGGTTAAAAAGCACTAGAAAGAC
TGTCTCCACGAAAAACATGCGAAATAGGTTCACTTCATACTCGAAAAGAATTCGAAGGAC
GCTCACAAGAAAGAGGTTTTAGGCAAACATGAAACGTATGCATTTCATAACACACACATA
TATATATATATTATATATTCAAAATAAAGCATAACAACATACATATTGNNAAAACAAAAA
AAAAAAAAAAAAGGGGGAAGAAAAAAAAATTTTTTTATAGATAAAACCAAAAAAAAAAGG
TCCCGGCCATAAGGGCCCCGCTTGAGTTTTCTATAGTGTCCCCTAAAAAANCTTGGGCNT
AATCATGGTCAAANCCGGTTTCCCGGGGAAAAATNATAAAGCGCTCAGAGTTTCNCCTTT
CTTTTTGTCCGGGAGGAAAAAGGAAAAAAACCAGGGGTTTCTTTTCCGTGAGCGGNNGGC
AAGTGTAATGTGGGGGAGGCAACGCNNCATGTTATTTTATGAGGAAAAATAAAAAAAAAA
AAANACAATAANGTCAACCTTCNTTTGGGAGTGGTGGAGGGGGGATACAAGACAAAAAAA
ATTAACACCCCCCACCCCAGCAAGAAGGGGGGGGGGNGGGGGNCGNTGTNGTTTTGTACT
GAAACNTTCCGAAAAAGGAAAACCNNCANACCCCACCCCCCCCCGGNGGAAGGGANGGGG
CGGTGGGTTATTTATTTGTGAATGAGGAAAGATAAAAATCCCACACGCCCCCCACGGAGG
AAGGGAGGGTGGTGTGCGGTTTTGNTTCTANTTTANTATTTTGNATAAAANATTTCGCCA
CACCACGCCCAGACATGGAGAAGGAGGGGGGAGAGATGAATTTTAGAAGTTTTTTGTNAN
AAACATAAAAAAAAANAAACCNNAATAACN
Quality >S03036-01_J09.phd
7 4 8 8 5 5 5 5 7 13 12 6 5 5 7 5 3
7 12 6 9 7 9 6 7 9 5 8 12 5 9 12 13 15
31 20 20 21 15 21 14 9 9 16 21 30 28 21 23 21 24
21 26 26 16 9 20 28 17 17 21 31 27 44 31 27 27 19
27 21 39 31 31 21 19 26 30 11 35 20 12 24 12 16 24
35 42 52 42 30 19 16 24 19 29 21 13 29 34 52 42 42
41 24 13 20 19 28 35 27 27 32 26 22 17 13 20 26 21
17 22 34 35 41 31 27 17 17 42 26 42 41 35 42 29 42
32 60 52 47 26 42 34 48 34 43 42 52 46 42 52 42 48
46 52 52 47 57 52 52 47 57 57 52 52 60 52 44 45 57
52 57 43 47 52 52 52 43 26 28 40 39 52 52 46 60 46
40 52 46 35 47 46 52 52 63 57 57 47 43 57 52 58 60
39 35 32 40 22 24 33 24 20 21 33 30 35 42 44 44 42
12 26 29 22 32 22 35 24 20 40 24 27 23 27 21 35 12
22 18 21 10 21 19 24 24 24 24 27 24 35 27 27 39 35
44 44 42 21 33 22 43 41 41 43 33 41 21 41 43 35 49
43 41 41 40 42 49 22 43 35 42 35 60 47 47 47 12 6
7 12 15 11 26 14 31 25 29 22 22 27 28 26 16 12 10
10 18 22 11 16 9 10 10 9 9 10 9 12 19 14 22 13
12 9 14 11 8 12 12 9 17 22 13 10 10 11 8 13 11
10 11 14 10 11 11 14 13 13 10 12 12 18 11 14 14 11
10 10 31 29 22 31 31 27 13 36 22 21 12 20 15 29 28
22 18 22 22 10 14 14 32 21 19 11 14 19 28 35 20 10
14 16 20 16 23 22 35 16 15 9 27 27 17 35 25 21 14
14 9 6 9 22 17 20 25 22 23 7 9 16 15 16 27 11
20 39 14 14 22 15 14 14 6 11 16 14 19 16 19 10 23
34 14 17 13 26 10 15 30 60 47 32 10 7 14 8 29 12
13 9 10 35 14 21 18 12 9 10 13 18 10 10 9 6 10
10 9 11 15 11 23 25 18 16 10 14 9 9 11 19 25 13
25 15 10 11 25 23 27 24 19 14 22 12 29 47 14 15 11
11 10 10 28 36 23 19 13 9 11 13 24 11 10 14 11 10
10 11 14 19 13 11 12 9 7 7 13 10 9 10 13 10 10
10 14 11 10 14 17 22 22 32 17 15 10 12 14 18 20 8
8 9 11 14 6 6 10 9 11 17 17 20 11 27 15 14 9
19 11 9 9 14 11 9 17 28 12 11 8 9 14 16 46 17
28 20 32 28 15 28 14 18 7 9 16 16 12 17 16 10 6
9 10 14 13 15 11 14 9 14 11 7 9 14 10 15 11 15
13 16 17 19 15 16 16 28 15 11 16 16 11 10 12 13 11
22 11 15 26 14 11 8 11 9 13 15 10 21 13 14 11 11
11 11 12 14 9 10 11 15 11 27 13 10 11 16 9 23 15
10 14 11 15 10 11 10 10 9 13 19 9 18 24 10 9 6
9 11 32 16 14 7 10 9 6 9 11 19 7 10 9 14 11
9 11 10 23 10 10 9 14 11 14 10 6 9 9 10 11 13
23 12 10 9 12 11 13 11 20 15 9 9 9 6 7 8 13
6 10 17 46 28 27 11 14 11 10 13 12 10 14 14 14 11
11 6 10 14 10 10 28 14 13 11 6 14 14 9 9 11 28
16 13 20 24 13 14 11 17 17 14 13 11 10 13 14 13 14
8 11 14 10 11 11 9 9 12 16 23 20 16 14 13 11 14
11 12 17 11 8 10 9 13 11 11 13 12 11 14 10 15 11
18 11 14 25 13 16 26 20 23 32 26 24 11 17 17 18 10
15 19 15 19 16 14 14 14 14 13 10 15 17 9 7 14 13
18 10 11 6 13 19 16 14 6 9 18 13 16 16 17 11 7
11 17 20 13 15 9 6 10 11 16 14 14 11 16 27 20 11
9 9 10 11 11 13 17 20 18 10 12 11 15 11 11 19 14
13 11 11 11 17 24 17 18 18 14 28 27 25 17 16 17 17
20 17 24 19 19 23 19 18 14 9 10 11 17 20 19 16 15
18 20 16 13 12 7 11 6 8 11 13 16 27 22 28 27 19
32 9 10 19 11 8 6 16 19 11 8 18 7 6 10 14 9
11 10 9 6