S03036-01_J11
Seqid S03036-01_J11
Sequence >S03036-01_J11.phd
GNNNNNNNNNNTNNNNTANGGCACNNNNNANAGGGNGATTGNCGGCCNANTCGGCCGAAT
TGGGGGGAAGATTGAAAATTGACGGAAAATAATATAAATACATATAAAAGACCTGATACT
TATTGACACAAATTTTCTGGATGTCCTTTTTCTATATGATATATATACGTCGCTATTGGA
TCGTAGGTTACTTGGCCATTATTTGAGCGTAACCCGTTAACATGATGTGGGCTTAAGGAA
TACAAAATCCAAATATGGAAAAAATTTGATATCAATTTAGGGCTTTGATATCTAAAGGTA
TTTATTTTTTTCACAGTTTTTTTTTGTTAAACTGTCTGCAATAAGGAATGCTCCTGACAT
AAAATTCGAAAAGGACCGGAAATAGTTGGAGCACAAGACTGCAAACTAAAAAGCAAATTT
CTTTGGAATTTCCTTACGCTTATAGTATATATCTTATAAATATTAAAATTAAGAGAATTC
AATTATTNGNAAGNGGGGGNAGNAGGGAAGAATTTNAANNTNNNNATTANATAAAAAAAA
AAAAAAANGTNCNNGGCNNTAAAGGCCANCTGNAGTATTCTAAAGGNGAAATNAAAAAAC
CCGGGCCAACCCCGNTAAAAGCGGGTGGGGGGGAGAANAGTAAGNNANTTAAAATTNTAT
TATAANGAGAAGAAAAAAAAGAGGGNAAGCCAGGNNGTATGTATTAGGTAGTAANGNAAA
AACACACACANCCGNCTCGTNGNNTGGCGNAGNNAANGGGGTNNAGGNNNTGNNTTAACN
NTAANNNANCAAAANNANCAAANNAGNGAGGGCGGAAGGGNNNCATGTAGAGGNNCCCAC
NNNNANGCACNANNACANNNGNNNNGTANANNNNTNAAGATCNAAGGNTGTACTGNCANT
N
Quality >S03036-01_J11.phd
10 4 2 3 3 4 4 5 3 2 4 9 6 5 3 7 9
9 7 9 12 9 9 11 5 5 3 6 5 18 6 15 9 8
8 6 24 31 16 27 18 6 12 22 21 10 10 6 9 6 30
22 31 21 30 26 29 26 12 30 28 19 15 19 23 25 28 20
23 20 20 16 33 28 20 28 37 33 20 32 30 23 26 46 36
26 19 15 18 25 16 30 28 35 46 35 35 29 35 29 31 12
26 19 30 31 30 26 33 33 28 28 26 26 32 19 19 27 28
39 39 36 42 38 43 34 42 39 46 28 42 46 49 51 53 53
44 44 49 49 45 44 49 50 43 46 46 49 49 49 50 54 50
44 50 54 50 54 50 49 46 46 51 49 47 46 49 49 44 49
50 42 42 44 42 46 46 50 49 44 44 46 43 42 49 44 50
49 44 46 44 44 46 51 50 43 45 43 54 43 43 43 28 29
33 53 43 27 27 43 44 43 43 37 21 38 38 27 42 42 38
18 44 46 44 44 54 42 44 43 36 44 42 42 42 42 43 49
39 32 26 32 28 16 20 24 21 38 42 29 42 44 49 49 43
50 57 54 50 54 49 46 44 44 39 43 29 44 44 43 42 44
50 39 54 50 47 46 49 49 51 47 35 46 46 46 54 44 36
49 54 54 50 54 54 44 49 45 20 42 36 46 44 49 44 49
49 53 53 43 44 37 39 42 32 39 43 47 43 43 46 53 47
47 43 45 36 49 37 30 41 35 49 50 42 50 54 50 42 18
49 42 35 42 32 20 29 43 27 44 39 36 43 38 36 38 27
33 22 42 35 25 33 32 26 20 22 26 14 19 18 20 32 44
27 21 35 42 49 44 44 44 32 32 49 36 43 31 21 22 20
27 21 27 19 16 16 20 27 38 36 27 22 44 43 39 35 38
22 25 60 60 44 44 44 63 46 35 33 38 40 42 21 23 23
21 21 23 27 38 20 32 43 42 47 24 42 39 35 33 44 42
44 23 28 33 35 60 22 41 30 30 42 47 43 33 27 14 41
41 22 35 21 27 25 21 31 27 25 39 20 21 13 35 13 21
26 12 18 16 11 9 17 19 9 11 10 6 9 7 9 9 8
6 8 13 14 18 10 7 9 9 6 9 9 9 11 20 10 9
27 12 9 11 12 7 8 8 6 6 9 6 7 7 7 8 9
9 9 6 9 10 12 9 18 9 9 28 36 47 45 32 26 17
33 19 35 7 17 14 6 11 6 6 9 14 11 6 6 9 13
13 9 9 10 19 19 11 6 18 11 8 6 14 10 12 9 14
17 18 8 8 9 10 9 10 6 9 9 15 11 8 6 11 11
9 9 14 11 9 11 10 9 11 9 12 10 9 11 9 22 21
9 9 6 9 10 11 11 9 9 11 8 12 8 10 14 19 19
17 26 14 8 13 11 11 19 6 9 13 9 9 9 9 6 6
11 6 11 9 10 9 9 11 10 10 7 10 9 11 11 16 9
18 10 6 8 14 8 10 15 11 25 9 13 18 10 11 18 18
9 18 11 9 9 6 9 16 10 12 14 13 8 13 6 6 10
8 9 10 8 10 8 12 11 19 11 11 8 10 9 11 16 14
7 9 7 14 14 9 14 10 9 23 9 8 8 8 13 11 5
10 12 11 6 9 8 8 9 9 5 8 6 6 9 8 8 11
9 6 11 9 5 6 9 10 6 8 9 11 10 9 5 5 14
8 12 6 6 6 9 10 7 6 10 10 13 9 11 6 6 9
9 10 6 6 6 19 6 9 14 8 12 10 7 5 10 6 8
8 12 8 6 7 9 11 6 10 9 9 10 10 11 13 8 9
14 9 8 9 7 6 7 8 8 9 11 10 11 11 11 9 11
5 5 10 10 9 10 14 5 7 5 5 10 6 9 11 10 10
7 8 5 6 9 11 9 6 6 7 9 5 5 6 7 14 8
12 7 11 6 6 6 7 8 6 9 9 11 11 8 9 5 9
11 9 9 6 9 11 11 8 10 11 9 6 9 11 7 8 5