S03036-01_J13
Seqid S03036-01_J13
Sequence >S03036-01_J13.phd
NGNNNNNNNNNNNNNNNNGGGNNNNCNNANNNNGGNGATTGNCGGCCAATCGGCCGAATT
CCCATGGGGATCCGATGGAGTGCGGAGTCTTGGTGAAACAGCTACTGAGAGAATAGGTAT
CTGGGTTACCAGCGTAGTTAGCTACAAGATGTTCGAAATGCATGGTAGAGTCTGGGTTTC
GTTCCCTTTGGCTTGTTAAGGCCGAAGATTGCTTTGGTCTGGATGGGCGGAGCCCAANTT
TTATTGTTGAACTATTTTTAGATTAAGAAAAACAGCGCCAAATTTTACCCGGCTTATGGC
TCCTCCNTTGGTACTCCCATTTTTANGACGTAAAAANNNTCCCNCTCCTTCCGGCGCGGN
NAGNGAAGTGGGGGAATTCTGTTTTTTTNTTNAANTACCAANAACCAACGNATGGACACA
NNTTGTTTTGNGACGACGTCTCCAGAATGAATAAGCTNNNAATACCACCTNCTTCCCCGA
CNTGANAGNNGAAGGNNGGACTTTATTAAAAATTNTAANTTTAGTAANNTGCAGATTTGA
GANNGCCGGNGGGAGTTTTGAAGTTTATGTTTAAAANANAGAAAAAANACACAATNNTCG
GNAANGAANGGGANGGAAGGTTGGGAAGGGGGGNTNNAACNANGNNCAGCTAATTTCACC
CCACAATACACGCGGAGAGTGAGATNGAAACNTTAATAGTNNTNNGANAAAATTTNCCNC
CACCCCCACCCAGCCCTNGGAGGGGGGGGGGGAGGGGTTGGATGGGTTAAGATTATAAAA
AANTTTAAANAGNAAAACTGNCCCGAGAGNNTANNGAGTTACGGACGGGAAGTGNGANAG
ATANATATNCCCCNCAANCNAANCCCCCCCAACAGGGGAAAACNATGGGAAAAGNNANNA
AGNTAAAAATGACAAANGTTCACTTATCAAAACTTNACAANATNTTTAATTNG
Quality >S03036-01_J13.phd
6 8 5 5 5 3 3 5 5 3 3 5 5 5 5 3 5
6 16 15 10 5 5 7 5 8 3 5 8 6 5 6 7 14
10 6 10 8 8 26 16 6 9 11 23 9 8 9 12 47 31
35 30 44 41 19 37 9 28 22 13 10 9 9 34 46 53 44
53 16 20 28 27 18 45 26 45 42 40 33 42 40 14 53 60
18 16 18 30 38 42 45 27 42 40 24 18 12 40 14 13 35
36 24 53 53 53 50 32 35 35 35 32 33 35 53 53 47 35
50 38 40 53 53 35 40 35 23 37 35 25 33 40 42 35 40
20 44 37 37 42 37 37 32 53 24 33 33 50 53 53 46 46
53 39 53 46 53 53 53 53 53 57 53 53 39 53 45 53 53
46 53 53 53 53 53 53 46 46 31 28 37 31 53 53 53 53
53 53 52 52 52 53 53 53 53 53 43 39 43 53 45 57 52
53 53 38 48 37 45 53 53 45 53 37 35 35 19 23 41 41
35 27 28 35 38 42 53 53 23 37 42 42 36 23 23 10 6
11 27 13 13 11 16 18 31 13 18 21 41 34 42 53 37 53
53 53 53 32 19 14 28 37 53 37 28 28 53 42 34 35 30
43 53 53 53 33 36 32 16 28 27 34 38 27 20 25 27 23
23 42 42 24 37 33 16 28 28 28 38 53 32 53 28 18 9
6 17 53 42 25 19 19 24 40 28 30 27 23 42 53 38 21
25 16 5 16 42 16 11 22 27 9 9 19 9 6 6 6 9
12 28 18 6 19 12 9 9 11 14 9 12 9 11 9 11 10
9 11 6 6 11 9 6 9 13 11 16 14 18 20 50 14 30
10 18 10 9 9 11 9 33 35 23 17 25 11 23 6 9 9
6 9 11 6 14 23 9 14 9 14 6 12 13 9 9 9 12
12 14 6 14 8 10 10 13 11 10 10 8 6 6 14 36 12
23 16 11 9 9 7 10 10 10 13 12 12 11 22 16 10 10
15 16 11 12 22 23 10 18 12 11 14 9 9 9 11 6 6
6 10 10 10 12 11 10 10 14 14 9 6 11 11 14 10 10
9 13 18 15 10 6 11 9 11 6 9 10 6 7 10 11 9
8 10 6 6 11 9 10 10 14 12 10 9 11 10 10 10 10
8 9 11 9 6 21 8 14 7 11 9 10 11 11 9 8 16
6 6 10 9 9 11 10 11 8 9 11 11 23 11 12 7 7
11 10 10 13 13 6 9 14 9 15 11 16 14 9 11 25 11
14 18 13 11 10 11 9 9 14 9 9 13 10 11 10 7 13
6 14 10 19 12 16 16 13 9 7 14 9 11 9 9 11 9
6 6 9 9 9 9 6 11 9 6 10 9 10 6 10 11 14
17 7 11 12 8 14 12 10 9 10 14 16 9 9 11 9 10
37 19 13 9 6 9 6 6 9 13 9 6 14 6 9 7 7
10 12 13 17 14 14 14 15 10 11 9 14 14 16 14 10 11
10 16 16 11 11 11 10 11 10 10 13 11 15 16 10 9 9
10 9 10 12 11 7 10 11 10 9 11 6 10 14 15 15 14
22 9 10 6 7 13 6 6 11 9 6 9 23 24 14 9 10
9 6 9 16 6 11 12 9 11 18 25 11 10 11 14 14 16
11 9 24 14 13 13 7 9 13 11 18 16 9 12 12 11 12
9 14 13 14 20 16 27 11 10 8 11 11 9 8 8 13 17
14 20 14 10 13 8 9 19 15 18 11 11 14 28 19 17 14
6 9 16 17 13 9 16 7 9 8 6 18 16 15 8 9 13
10 7 13 12 19 11 12 9 14 15 6 7 8 19 6 7 9
8 26 11 9 10 11 11 11 10 11 11 14 14 9 9 14 9
9 6 9 12 6 9 10 11 9 9 6 8 10 9 10 6 9
10 14 13 6 8 10 16 6 11 6 9 10 6 9 10 9 8
10 9 9 10 10 10 10 13 9 9 11 11 10 11 11 9 6
9 11 11 14 14 14 9 10 11 9 6 6 9 6 6 11 11
9 6 10 9 9 11 9 14 10 14 14 9 19 11 18 6 9
8 10 11 16 21 9 12 13 19 14 11 23 17 15 10 12 10
7 8 9 9 10 7 9 10 7 11 18 16 11 11 10 10 6
9