S03036-01_J14
Seqid S03036-01_J14
Sequence >S03036-01_J14.phd
NNNNNNNNNNNNNNNNNTGGGNNNATNNNNNANGGNGATTGGCNNNCAAATCGGCCGAAT
TGATTGGTNAGCAGTATCGTTCAGCGTGTGTATTTTCGATAGGAAGCAATAATTTTTCAT
TATATTAATTAATAGTTTCCAGAAAAAATTTTTTTTCCTTTCACAATTGCAGCAGGCTTG
AATAGAAACAGAACAAACGAGTAATACAAGGATGTCTGCTACCAAGTCAATCGTTGGAGA
GGCATTGGAATACGTAAACATTGGTTTAAGTCATTTTTTGGCTTTACCATTGGCCCAAAG
AATCTCTTTGATCATAATAATTCCTTTCATTTACAATATTGTATGGCACTTACTATATTC
TTTGAGAANGGACCGTCCACCTCTAGTGTTTTACTGGATTCCATGAGTCGGTAGGGCGGT
GGNGGNNNGGATGAATNCATAGGAGTTNATCNAAAAATNNCCCCCNNAGCACGNCGGGAG
AAAGGCAGGGGGGGAAAAATTGGATTANAANTCTTANTTACATNATCGAACNAACGCCTG
TGGCGGGGGAGTGTGGGAGGGGGGAGNATATTTGAAAANTTGTANTGGAAGCAGANTANN
NAAGNANAGGATCAAGTAAACAGGTNGNGGGGANNATAACGGGNNANAACATGGACNCAG
AGTNAGTNGTGNACGTGCCGNTGAAGGCCGCTGTGCCNAAAAGCAANAAANCCCTAAGGG
NAAAGTAGTTTGNTCGAAANGATNNGNCGTCGTNGNCCTTNAANTCTCNNTGNTTNCTGA
AGCGTCCTATAANANACNACAACGGTAGNANANNCCAGGNNGGNATTGAGCNGNANNNAA
GANGATGNCCNNGTTAGGTCGGANNCNGGCTAGNCAGAANNGGAAACTCNTTNCCNGTTT
AAAATGTTTN
Quality >S03036-01_J14.phd
6 5 5 6 6 4 6 6 4 4 3 5 7 7 3 3 5
12 15 21 37 5 5 6 9 9 6 6 5 7 7 8 5 13
11 6 17 18 15 19 29 11 9 7 7 5 10 9 9 10 26
18 27 30 30 29 18 26 13 35 25 12 9 20 34 33 25 11
7 9 11 21 11 9 17 20 27 25 24 24 22 16 25 23 34
34 19 22 13 13 19 26 32 35 34 26 35 9 22 24 12 13
23 21 21 14 39 11 19 36 31 29 32 45 39 39 41 42 27
44 45 26 24 19 27 27 32 24 41 53 46 42 60 53 39 57
60 53 60 40 19 46 57 41 18 42 36 42 53 60 60 60 60
60 60 53 53 60 57 60 52 52 53 57 52 53 57 53 53 57
53 52 60 60 53 52 52 57 53 53 53 53 52 53 38 45 53
57 60 52 57 52 60 57 52 53 57 57 57 58 57 57 60 53
57 53 60 52 57 57 53 40 52 57 60 53 47 53 53 53 53
52 52 41 37 53 60 53 35 46 45 53 47 47 53 52 52 60
53 52 52 39 18 16 11 15 23 53 38 27 44 34 45 42 53
47 42 45 53 18 53 52 52 53 52 57 52 53 53 60 57 60
53 52 57 57 57 60 53 57 60 41 60 57 52 53 53 43 45
52 52 52 52 52 57 52 27 53 53 53 52 60 53 57 57 53
57 57 53 60 57 57 52 45 45 60 53 53 53 53 53 53 53
53 53 53 52 53 40 53 45 35 41 53 34 29 45 45 45 34
45 23 13 18 17 12 25 9 10 18 21 20 31 13 20 18 16
16 19 36 19 32 33 53 37 20 19 11 7 12 31 23 28 33
19 35 42 19 9 35 38 30 44 18 12 12 23 37 28 19 28
29 33 18 13 23 16 26 20 17 28 24 28 22 18 8 14 16
23 9 9 11 11 13 10 20 11 11 17 13 9 16 6 18 9
6 6 6 20 13 12 9 15 12 9 8 6 9 18 14 19 12
10 18 21 10 9 6 10 10 11 6 8 9 9 18 10 8 6
7 9 8 9 9 9 7 6 10 9 13 12 18 9 6 9 12
10 14 14 15 11 11 11 13 15 9 10 10 9 16 11 15 21
10 11 12 13 13 14 11 8 11 8 10 9 10 10 7 9 11
7 10 10 17 18 10 6 9 9 18 12 10 10 7 10 11 12
10 11 10 11 7 9 8 10 11 10 15 11 8 15 13 10 8
11 14 14 19 16 16 9 8 12 8 13 16 22 11 9 11 12
11 9 18 9 14 7 18 10 11 16 20 19 9 8 10 14 12
7 9 11 9 9 8 6 14 9 11 14 13 11 8 9 9 10
7 9 9 6 6 6 9 15 11 7 10 7 9 14 12 9 9
10 13 10 11 9 14 9 11 8 9 11 10 9 7 11 7 9
9 11 9 10 6 7 12 11 9 9 9 8 9 11 6 6 11
6 10 12 11 12 11 11 9 8 8 6 10 11 9 11 11 11
6 9 10 9 6 9 9 10 6 13 8 11 11 10 10 8 11
6 10 10 10 11 9 10 11 9 8 8 8 10 8 9 9 8
6 14 10 11 11 11 9 10 11 6 14 9 9 6 11 11 9
11 14 9 10 11 8 6 9 9 9 9 9 9 10 9 9 11
14 7 9 11 8 9 11 8 6 11 11 11 6 6 9 6 11
9 8 9 9 9 6 11 6 9 9 11 16 6 9 14 7 9
8 9 8 6 7 9 9 5 9 9 6 9 11 11 11 18 9
9 14 9 11 14 8 14 11 14 14 6 10 6 8 9 7 11
11 10 14 9 10 11 11 11 8 6 19 6 11 6 6 11 9
14 14 8 6 6 9 14 6 16 11 8 10 11 11 8 6 10
6 9 6 6 6 9 8 8 10 6 8 8 9 9 6 8 8
6 6 9 10 11 11 11 10 11 9 9 10 11 6 6 8 6
11 14 11 10 11 9 6 8 11 9 10 9 6 6 8 10 8
14 9 8 8 10 7 9 9 7 9 9 6 9 16 13 14 14
10 10 9 9 9 11 11 10 6