S03036-01_J15
Seqid S03036-01_J15
Sequence >S03036-01_J15.phd
GGNNNNNNNNNNNNNTTGGNNNNANNNANAGNGGNGATTGGCGGCCANTCGGCCGANTGA
TCTGATTATTCNATAATCTCAAACAAACAACTCAAAACAAAAAAAACTAAATACAACAAT
GTCTGACGCAGGTAGAAAAGGATTCGGTGAAAAAGCTTCTGAAGCTTTGAAGCCAGACTC
TCAAAAGTCATACGCTGAACAAGGTAAGGAATACATCACTGACAAGGCCGACAAGGTCGC
TGGTAAGGTTCAACCAGAAGACAACAAGGGTGTCTTCCAAGGTGTCCACGACTCCGCCGA
AAAAGGCAAGGATAACGCTGAAGGTCAAGGTGAATCTTTGGCAGACCAAGCTAGAGATTA
CATGGGAGCCGCCAAGTCCAAGTTGAACGATGCCGTCGAATATGTTTCCGGTCGTGTCCA
CGGTGAAGAAGACCCAACCAAGAAGTAAATCTTTCGGAACTCTTTGTAGTTACATGGTTT
TTTTCTTTATGATGGNTGGGGTGGGGTAATGGATATTCAATGAATTNCANANGNATNGAN
AAATACAAAAAAAAGGCCCCCCAATCCNCNGTGGNATATAGGNACTNAAGAAANAAAAAT
TCCNNATNCNTTCCTCCCCNTGGAGGGTGAGGGAGAAGAANAGATTTTATATTATAATTT
NAAAGAAAATAAAAAAGAAAAAAGNCGGAATGGCANNCCCGNGGGAGGGGGGGAAGTGNN
AAAAGANAACCCCACAACCAGCNCGAGGANAGCTAGGNNNNNGTAAGGAGANGNTTGTTN
ANNNNACNANNNATCAAAAAAAAAAAANAANNCNTTANAAAGNGGAGGCNGGGATTAGGA
GGTGGTAAAATNCCGGACCNNNCCTNTGTCNGCANCNCAACTNNACATGATTATCGNNGA
GGNGNANNGNANATCTCN
Quality >S03036-01_J15.phd
12 8 5 4 3 5 4 5 6 6 5 6 6 3 5 9 12
9 8 6 6 7 5 9 5 5 5 18 6 12 9 6 10 14
7 17 24 17 23 23 8 10 11 29 11 11 8 6 19 18 16
17 26 23 18 13 7 12 15 11 16 16 35 28 26 15 17 32
32 20 17 6 17 24 33 29 29 30 27 26 26 30 34 34 23
20 19 41 23 35 46 46 35 32 18 30 22 30 16 12 15 13
13 15 13 21 23 20 16 19 19 26 21 27 16 15 29 27 21
43 49 43 35 29 42 32 28 22 54 42 38 49 31 28 36 34
39 42 43 39 54 28 44 50 59 36 44 43 44 44 43 46 49
49 46 47 60 49 50 60 60 50 49 60 47 49 47 43 47 44
49 43 44 49 47 49 45 44 46 43 46 42 47 47 49 49 49
46 44 49 60 47 44 42 58 58 50 63 63 42 35 22 22 43
49 60 47 47 58 52 41 42 57 47 44 60 57 47 52 57 44
35 60 34 60 35 40 43 60 47 42 29 28 40 60 60 34 40
32 16 18 35 57 22 20 20 21 63 19 40 21 29 44 40 40
22 40 52 57 42 52 30 32 22 43 35 40 60 57 52 57 60
46 47 57 52 57 43 29 60 57 60 57 60 60 60 60 47 40
35 52 21 52 57 46 29 60 57 35 41 22 29 47 60 57 45
29 60 43 43 43 26 35 22 41 35 42 46 52 42 52 63 29
63 42 60 28 43 47 63 40 43 41 43 47 47 60 47 43 37
41 47 28 40 35 16 40 24 35 40 43 39 35 40 21 20 30
25 21 21 37 17 57 41 33 33 19 29 25 21 16 28 40 22
40 44 47 52 43 24 43 43 43 41 40 37 35 34 42 43 35
40 40 40 27 60 47 23 37 44 40 39 44 52 47 45 43 47
57 46 45 34 44 57 60 57 47 35 57 30 42 42 63 28 44
35 16 29 43 52 46 52 20 28 43 27 42 60 60 35 52 42
41 30 20 35 32 23 28 41 42 47 47 60 42 41 48 41 41
29 60 35 47 48 43 47 28 23 29 40 33 20 33 19 29 35
41 20 21 28 32 17 14 18 15 11 29 29 22 13 19 19 10
16 8 7 8 10 8 9 17 8 13 9 10 9 9 10 13 10
9 10 11 16 16 16 23 12 11 11 16 13 10 10 11 10 7
12 21 7 19 6 8 7 19 13 6 9 11 7 11 29 19 10
9 10 13 13 27 28 14 33 11 9 8 9 17 11 34 9 9
10 10 11 13 23 13 6 8 6 9 18 15 16 6 13 16 11
21 10 9 9 6 10 10 9 7 18 15 14 10 11 19 7 12
9 13 13 12 23 18 13 9 6 6 11 14 6 8 7 9 11
9 9 8 11 10 21 9 6 10 12 18 8 24 13 14 11 16
9 11 18 20 10 10 10 11 10 14 9 6 9 9 11 11 19
11 10 9 9 8 10 11 14 11 14 11 10 9 10 7 10 13
14 11 8 9 35 36 9 19 9 11 8 12 11 10 9 11 19
9 11 14 10 6 14 9 9 11 16 9 11 11 9 10 6 7
11 8 12 9 6 8 11 10 10 14 14 10 18 11 8 13 19
14 9 9 11 5 5 10 11 8 19 10 14 6 11 11 9 16
23 14 12 14 9 16 9 19 11 9 9 6 9 10 9 9 11
9 6 9 14 9 9 9 9 9 7 6 6 6 6 14 8 8
10 14 40 10 11 9 6 9 6 10 9 10 8 12 6 9 6
6 6 6 11 9 7 9 7 6 6 10 10 9 14 42 37 38
13 16 16 11 10 11 14 14 6 19 9 6 6 8 6 9 11
13 6 9 9 9 9 6 12 11 8 10 10 11 6 9 13 9
9 10 9 10 16 14 8 9 11 9 10 8 10 9 11 9 10
8 6 9 11 9 9 9 8 9 6 6 5 9 13 10 6 9
9 8 8 6 10 9 9 6 11 6 14 11 9 9 9 7 6
8 9 9 8 10 10 10 10 10 8 11 10 5 5 15 10 10
10 6 9 6 9 7 5 11 7 17 6 14 11 10 9 9 5