S03036-01_J16
Seqid S03036-01_J16
Sequence >S03036-01_J16.phd
NNNNNNNNNTNTNNTTNNGNACNAAANANAAGGNGATTGNNNGGCGGGTCGGCCGAATTG
AGATAGATAAATTCCTCAAGACGAACCTGTCTTTTATATGTTAAGATTTGATATCTAATC
TCACCAGACTCTCAAGTTTTATCTCACAACCTCGCGTTTGCCATAATTTTCGAAGTAGCC
TGATCCCTTCTTTGTGAACATATTTCACTGGAAAAGTACATAACTTTCATAGCGTAGTTT
GAAAGTATGCAGCTTTGCTACCGACCTTAAAGAATTATTACACTATTATGGAGCAAATCA
ATTCGAACAGTAGAAAAAAGAAGCAACAATTGGAAGTATTCAAATATTTTGCAAGTGTCC
TGACAAAAGAGGACAAGCCTATCAGTATCAGTAATGGTATGTTAGATATGCCGACAGTGA
ACTCCAGTAAACTCACAGCAGGAAATGGNAAACCTGACACGGANAAGCTTACAGGAGANC
TAATTNTAACGTACGGGNNNTNCANGGAAGTGTTATNATGTNCAATGAATNTTAANTCGN
NATGATGGGAAAAATNGGTCCATCCAGACCNGATACTGAATAANNAAGAAAGAACAACCC
CCTACTNNATTCGGCGGANGAGGGGGGGGGAGGNGGGAGGGTTTTTTTTNTATTTTNNTA
TAAATNAANAAAAAAAAAAAAAGAGGGGTNTGACTTACTGGTGTCAGCTAAAGANTTNTN
AAAAATANCACCCCNAACCTTCCCCCCCCTTCCNTAGGNTAGGNNGANGAGGGGGGGTNG
NNCAATTANATTATAATACAANNCANATAAAANGGGNNGAGCCNGGCATGGNCAGACCTA
TAGTANNAATTGGGNAAGCAACAGCACNCCNCCCCNCNTTCCCACCGANTCCCNANGCAA
ATGACANNNNAAGNAAAGAACAATAAAANTATTNGN
Quality >S03036-01_J16.phd
7 5 4 4 3 4 3 6 5 8 5 8 5 5 9 10 6
6 8 6 10 11 6 9 8 12 5 13 6 9 9 11 9 5
9 16 10 16 17 7 6 6 9 11 8 8 9 10 20 17 16
16 17 19 14 20 12 19 13 10 9 9 11 15 22 14 21 14
22 28 19 26 10 18 20 24 23 27 17 37 34 22 28 44 36
39 22 22 22 18 42 39 42 42 38 23 27 10 19 19 21 15
12 10 31 44 32 29 27 35 26 28 27 28 29 24 35 35 42
46 35 32 30 27 29 23 41 48 40 57 57 42 32 21 35 46
47 60 60 48 37 57 57 57 52 46 44 41 37 42 46 57 60
57 57 57 57 60 48 58 57 52 52 52 57 60 57 60 47 47
57 47 60 57 52 52 42 41 47 52 43 48 52 60 57 57 52
60 54 57 60 60 48 58 60 60 57 57 60 52 57 60 63 57
60 53 57 52 52 53 52 47 53 53 53 45 45 45 52 53 47
31 39 44 47 46 35 45 24 39 39 39 45 48 28 36 33 29
26 21 39 36 26 30 35 47 41 44 46 41 29 47 57 57 48
45 57 53 43 30 52 53 53 52 47 60 60 48 36 60 53 60
57 47 52 63 57 52 63 63 57 57 52 63 57 57 52 60 48
63 58 63 60 52 47 57 60 57 52 53 60 57 48 48 37 48
60 57 47 46 42 46 42 52 52 57 47 60 60 57 57 60 60
48 43 48 63 53 43 48 60 57 52 48 43 48 60 52 48 43
40 34 27 34 43 43 35 23 23 34 40 47 20 20 21 35 43
36 40 40 30 47 35 23 23 24 27 11 19 43 37 57 46 46
34 21 43 34 33 48 57 60 48 52 47 43 32 46 34 19 14
23 30 23 40 48 21 23 40 48 48 48 43 43 57 57 43 43
29 41 46 44 30 48 42 52 48 60 47 52 52 48 60 43 35
24 30 15 16 37 35 35 25 35 27 35 21 41 42 42 35 43
19 24 37 52 57 12 7 14 24 16 30 47 37 35 23 28 60
42 19 12 16 7 13 29 29 42 25 24 28 35 19 13 23 41
22 11 6 20 20 14 9 12 12 6 9 12 14 11 9 11 14
9 8 9 10 6 7 7 11 6 11 9 6 11 11 9 14 10
13 9 9 16 9 18 7 9 10 10 9 6 9 8 10 9 9
18 9 11 6 13 12 10 13 6 9 9 9 6 6 11 11 11
14 10 13 11 11 11 9 8 16 9 14 7 9 8 12 22 9
10 8 8 8 10 11 19 16 19 7 11 17 24 33 10 10 18
20 32 9 33 16 6 6 8 13 10 19 10 11 12 11 13 11
9 13 8 12 13 11 11 9 8 14 9 6 7 9 11 9 9
10 9 10 14 11 10 7 12 10 16 18 14 19 32 19 16 17
11 9 14 10 6 14 12 14 10 11 12 10 22 10 16 28 9
10 11 10 6 9 10 12 9 9 9 6 6 12 16 10 11 11
13 9 6 9 11 6 9 19 8 37 18 14 12 11 20 18 23
22 12 17 12 9 14 11 11 10 7 9 11 16 20 13 17 13
9 16 9 11 10 10 10 10 10 11 9 10 12 11 14 15 12
6 10 8 7 11 6 11 12 17 27 40 9 12 7 9 10 16
11 9 11 6 9 9 15 12 9 9 10 12 11 18 16 38 40
27 9 9 10 13 6 8 9 10 13 6 9 9 10 11 6 6
11 9 6 11 17 13 14 16 13 11 14 8 9 7 11 7 6
9 19 9 10 12 8 6 10 9 11 9 9 8 11 10 10 8
10 11 6 6 11 11 7 14 8 13 18 11 9 7 9 9 10
6 6 11 9 9 11 11 6 9 14 11 10 9 11 10 7 9
11 11 11 10 11 10 10 8 13 9 9 11 7 6 9 9 8
11 9 9 9 6 14 9 16 10 19 8 9 9 9 9 14 15
7 9 8 6 11 20 18 11 6 8 6 8 11 9 14 9 11
12 24 9 9 6 11 9 12 9 6 10 7 14 9 9 8 9
9 10 9 11 8 6 6 6 6 10 8 9 6 9 11 10 8
11 10 9 9 9 8 14 18 14 28 6 9 9 9 9 6 10
6