S03036-01_J17
Seqid S03036-01_J17
Sequence >S03036-01_J17.phd
NNNNNNNNNNCNNNGGNNNAGNNANANGGNNATTGGCGGCCAATCGGCCGAATTGAAACC
AAACTCTAGCCTCCAATAGTCACTAAAGATGAAGTACATTCAAACCGAACAACAAATTGA
AATCCCAGAAGGTGTTACCGTCAGCATTAAGTCCAGAATCGTCAAGGTTGTCGGTCCAAG
AGGTACTTTGACCAAGAACTTGAAGCATATTGATGTTACCTTCACCAAGGTCAACAACCA
ATTGATCAAGGTTGCTGTTCACAACGGTGACAGAAAGCACGTTGCCGCTTTGAGAACCGT
TAAATCTTTGGTTGACAACATGATCACTGGTGTCACCAAGGGTTACAAGTACAAGATGAG
ATACGTCTACGCGCATTTCCCAATCAACGTCAACATTGTTGAAAAGGATGGTGCTAAATT
CATTGAAGTCAGAAACTTTTTGGGTGACCAGAAGATCAGAAACGTCCCAGTTAGAGATGG
TGTTACTATCGNATTCTCTACTAACGTAAAGGACGAAATCGTCTTATCTGGTAACTCTGT
TGAAGACGTTTCCCAAAATGCCGCTGACTTTGCNACAATCTGTCGTGTTAGAAACAACGA
TATCCCTCACCTCTATGGAGAGTGGGGGAGGGTGGAAAANGTTATTTTTTTTTTAATAAA
NAAAATGAAAAAAAAAAAGTGTAGCTGCGCTTTACACATCACTATCACACAGGTGAGGGG
AGAGGAGAGGAGNAGGGTGTTTTTTTTTATTGATTNAAAAAAAAGAAAAAAAAAAAGCAG
CTTTTGTANNTACTCTTTATGNTANAAAAAAAAAAAAAAAAAAAANANTAAAAAAAGATA
ACAACANGGAGGAGGGAGGGGGGAAAAAGNGNNTGTTTAAAAAA
Quality >S03036-01_J17.phd
6 3 3 3 3 2 4 7 7 6 8 6 5 5 8 12 5
5 5 11 10 5 6 8 6 8 5 14 9 5 5 9 11 10
20 10 17 28 17 9 12 9 9 22 25 18 23 21 26 26 22
15 36 29 19 13 14 16 20 19 20 31 28 30 31 38 36 22
26 30 28 32 46 27 18 44 42 42 40 46 43 28 30 31 28
28 35 43 33 30 41 42 28 30 32 20 35 26 36 35 28 25
27 30 33 28 28 28 23 27 23 26 33 27 22 30 39 38 43
30 42 35 43 50 43 35 39 34 52 42 39 49 43 49 50 47
47 44 50 60 47 50 60 44 50 44 49 42 47 49 49 47 43
42 45 60 57 49 49 50 49 60 47 44 60 52 57 60 57 57
57 52 60 52 52 47 52 42 42 52 52 52 52 57 57 52 57
63 63 63 45 44 41 52 63 52 63 46 52 58 60 57 52 57
60 60 57 60 57 52 57 57 52 52 57 57 52 60 48 60 60
57 52 41 48 48 42 60 57 60 42 42 39 42 41 35 47 37
26 30 47 47 57 57 52 52 48 60 57 57 63 60 43 48 52
60 57 57 52 57 60 60 52 57 57 47 60 52 48 48 42 40
48 53 53 48 57 57 57 52 63 63 63 57 57 48 48 52 57
60 60 57 48 52 52 57 34 48 48 60 48 40 48 48 57 60
57 58 48 48 52 52 63 43 48 35 42 60 57 46 57 48 48
42 52 52 47 60 57 53 57 57 52 40 35 34 48 29 60 42
43 21 20 23 35 47 21 40 40 35 34 60 22 57 52 52 46
60 57 44 52 26 35 35 35 35 60 47 60 57 40 57 57 52
60 60 58 57 47 57 44 47 52 52 42 47 40 60 60 60 42
60 40 34 42 52 63 52 42 57 60 45 45 63 60 29 58 44
20 47 46 42 47 42 47 40 41 43 49 60 47 24 47 60 49
47 51 42 49 40 28 49 45 41 41 35 60 63 43 43 58 54
63 58 47 49 42 19 43 31 42 50 63 27 44 17 47 31 35
39 37 33 35 35 35 31 38 34 28 35 35 32 27 21 40 16
39 33 35 44 33 42 33 30 31 44 31 34 39 39 11 7 22
16 29 31 25 22 22 34 26 38 27 44 15 11 18 32 50 39
36 42 44 16 16 36 38 26 27 22 19 30 34 44 54 27 31
42 42 44 39 29 44 44 31 22 27 19 31 22 39 34 15 26
9 21 16 14 17 16 31 28 23 25 24 29 27 38 38 39 17
44 29 31 31 11 11 13 17 34 31 30 18 6 33 22 18 21
14 14 14 35 27 31 30 31 22 14 17 16 9 39 38 38 13
23 19 8 11 19 13 19 15 18 31 23 11 13 18 13 12 11
12 25 11 11 21 19 19 15 15 16 9 12 11 11 14 17 17
21 18 8 10 9 10 10 13 11 19 7 19 12 22 13 31 15
14 33 25 30 25 34 25 17 22 24 10 19 9 10 6 10 22
23 52 9 9 14 20 23 15 15 15 15 30 23 20 11 12 8
19 11 10 10 8 28 18 18 12 11 11 19 11 10 11 13 11
13 12 14 13 18 11 13 14 10 8 8 10 11 10 13 13 17
13 10 11 14 9 11 11 18 9 14 24 17 27 20 12 8 11
9 6 10 15 12 9 9 11 10 14 11 15 32 46 27 15 27
15 17 22 14 12 10 8 6 17 18 26 32 27 24 28 50 9
9 10 15 22 34 9 13 10 12 11 19 15 9 9 11 10 9
10 11 11 10 15 16 7 6 14 11 11 12 10 14 13 15 11
9 9 6 9 11 6 11 8 10 10 14 15 41 40 25 20 26
28 32 32 27 15 11 10 14 10 6 12 6 9 9 11 11 12
10 9 9 9 9 9 11 11 9 9 12 15 9 7 10 13 13
16 10 22 21 15 11 10 22 8 14 11 12 9 11 9 10 14
19 14 6 10 6 6 9 9 8 9 16 13 14 12 11 20 13