S03036-01_B01
Seqid S03036-01_B01
Sequence >S03036-01_B01.phd
NNNNNNNNNNNNNTCNNGNCNCNTCTNNNNAANGGNGATTGNGCGGCCAATCGGCCGAAT
TGACAACACTAGGCTACACAGATGAGTTCAAGATTTGCAGGGGGAAACGCTTATCAACGT
GATACTGGTAGAACACAGTTATTCGGACCGGCTGATGGATCAAATAGTCTCGATGACAAT
GTATCATCAGCGCTAGGGAGCACAGATAAATTAGACTACTCCCAAAGTACTTTGGCATCT
CTTGAATCTCAAAGTGAGGAACAGATGGGAGCTATGGGTCAGAGAATAAAAGCACTCAAG
TCATTATCGTTGAAGATGGGTGATGAGATTAGAGGCAGCAATCAAACTATTGACCAGCTT
GGTGATACTTTCCATAACACTTCTGTAAAACTCAAAAGGACTTTTGGAAACATGATGGAG
ATGGCCAGAAGATCTGGGATCAGTATAAAAACATGGTTAATAATATTTTTTATGGTAGGC
GTGCTATTTTTTTGGGTATGGATTACATAAATATTTGCATATTGTACATTAAAACCTAAA
TGACAAAATAAGANCGGNNGTTTGTTGTGGGNTNGGANGAAAAAGAAAAAAAAATAAAAA
TANCTTAATATCCTGCAGGGGTGGGGGGGGGGGGGGGGGGGCCGGCCATATAGCTCTTTT
TTAATATTTTTTAAAGGACCCAAAAGAANCCTGGGCNGCCCCCGGCCCAGNATATTATAC
GGGAAAAGAATTTATCTCCCCTCCCATCCTCCCCCCCCGGGCCGGGGGGGGAGGGGGAAN
GGNGATGTACTTTTTTTTTTATATTATGAAAAAANAAAAGGAANACAACCGGAAGAAGGG
GGGCGNATTTTACCAANNGGGAAAAAATTAANNATAACTTTTCTACCCCCCCCACACCCC
GGNAGNAGAGAGAGAANNAGN
Quality >S03036-01_B01.phd
3 3 3 2 3 3 4 2 3 3 2 5 7 9 10 7 7
8 7 8 6 19 6 9 9 8 7 5 5 5 10 9 6 14
8 5 16 24 21 27 16 6 11 9 23 25 14 13 9 8 26
36 32 31 30 27 33 27 9 25 34 27 15 20 12 14 21 29
28 24 31 37 30 30 28 30 33 42 32 42 37 32 28 44 41
35 49 49 32 15 22 36 29 18 41 40 47 46 30 36 43 29
37 49 35 36 31 31 30 38 36 32 36 43 35 41 35 46 43
47 43 42 50 46 42 49 45 51 50 49 42 50 41 46 38 46
38 42 51 50 43 50 49 49 43 49 42 29 49 41 43 50 50
45 45 32 45 49 44 38 49 43 43 53 51 50 49 54 57 50
54 60 50 60 50 45 44 44 49 60 60 63 60 47 49 54 60
54 50 60 57 60 63 58 57 52 63 43 52 35 63 52 52 47
57 58 60 60 60 60 57 52 52 57 52 52 52 52 52 52 60
53 53 35 52 60 60 52 47 52 60 57 57 52 48 41 43 57
43 35 40 26 34 43 29 35 40 40 48 52 47 52 63 46 60
57 52 39 60 48 57 41 41 52 48 42 47 60 48 48 28 48
32 47 47 57 63 53 48 57 42 39 57 24 48 53 35 60 53
53 53 35 40 37 52 57 47 35 52 48 40 37 41 34 53 30
40 37 42 37 53 37 35 33 27 48 22 47 63 53 47 60 35
16 48 48 24 48 28 53 41 26 43 27 58 30 41 34 35 29
48 40 35 22 57 48 43 34 47 48 43 48 46 42 53 27 48
57 43 43 30 43 34 60 42 28 43 40 47 43 46 52 57 44
52 42 58 47 39 52 60 63 52 60 57 52 34 57 57 43 47
60 39 34 52 60 60 28 63 42 33 44 63 63 46 44 47 33
63 63 40 24 47 60 43 35 60 58 47 22 44 28 47 51 21
51 24 35 36 41 24 47 22 42 35 44 63 63 44 27 31 22
42 42 34 39 29 49 49 46 49 39 13 31 42 54 28 50 35
57 35 39 44 39 29 39 46 46 42 42 42 29 36 36 36 22
27 18 32 28 23 32 28 28 36 27 36 42 42 39 39 42 39
42 54 42 19 24 19 35 43 24 16 19 16 31 29 29 27 42
39 24 18 21 31 35 20 18 11 27 14 23 26 22 16 20 15
11 22 27 10 19 19 27 12 42 20 25 19 13 21 22 27 14
14 19 31 22 19 16 27 12 16 7 14 11 9 7 7 8 11
13 10 16 14 18 9 10 9 9 10 6 9 7 11 9 11 6
8 9 9 16 26 13 11 21 21 18 35 22 31 17 22 16 9
10 16 9 16 15 12 13 7 11 10 8 9 8 10 11 8 9
13 9 9 13 17 17 16 21 24 10 25 25 15 27 20 24 22
15 17 29 15 15 10 15 25 30 17 17 19 17 9 23 15 11
11 11 24 19 12 9 19 13 11 12 11 22 26 18 18 10 9
10 16 16 35 19 12 14 14 9 10 12 10 10 10 10 13 19
11 11 14 14 19 16 22 12 7 9 10 15 16 14 14 12 7
9 10 10 19 20 14 13 19 9 14 10 12 14 7 8 9 11
12 12 11 13 16 10 9 34 11 20 11 12 19 11 11 20 13
10 15 13 19 13 10 32 32 19 13 14 20 20 32 16 12 10
10 13 30 40 28 20 16 15 15 17 20 15 13 14 18 18 9
11 21 16 19 32 19 12 25 40 11 14 14 16 9 6 9 10
7 9 10 9 11 9 21 16 16 12 11 12 12 22 40 13 11
14 14 19 14 12 9 10 8 10 11 20 10 14 28 13 6 11
10 9 13 8 10 14 9 6 11 10 10 9 9 12 9 8 11
24 14 9 10 11 11 10 11 10 16 18 14 7 9 14 11 11
11 14 12 20 17 14 6 6 14 14 18 10 21 18 8 24 9
14 9 11 9 6 6 10 13 11 16 22 20 13 13 14 11 8
8 9 10 14 10 11 16 24 20 14 19 13 14 10 14 17 19
9 6 9 13 6 9 11 12 13 12 10 10 16 9 11 6 6
8 11 6