S03036-01_K01
Seqid S03036-01_K01
Sequence >S03036-01_K01.phd
NNNNNNNNNNNNNNNCNNNNNNGNNNNNNANGGCGANTGNCGGCNANTCGGCCGAATTGN
ACAAGAACATAAAAAATTGTTTTTGCTACATTGGTTTCACATAACATATTTCAACAAACA
TGCCATCAAATTTGAATATAGTGAAGGTTACAAAACCACAAGAAGAAAATAAGAATATTT
TACACAAAAACACGAATGAACCCAATGAAATGGAACAATCGCAGACACAAGAAGCAGTTA
CAGAAAATTTTACCGAAAACAGTAATCTCAGTGCAAATGAACATGCACTAGGAGGGGTAG
ATTAAATTTGAAAACAGTTGATCACATAGAAACTTATCCAATAGTGCAAGAAACAGAAGA
GATTGCAAAAAAGATTGCTCTTACGAGAATTATTTTAGCACAAACCAAGCCTAGNATCGA
TTAAGTGGTAGTGTCACGTCCCGTTCAAGCCGTAGCACCAGTGGTCAATTTTTTTGACAA
GATGGCCAATTCGACTTTAAGTACAGTAGAGCGCGTTGTNCCTTCTTTGAAAACAAAAAC
TTATAAAAGATTAGGTGAGGAAANTGCACTTCCGTATACTTTGTCGAAAAAGTATGGAAA
GCAGCTCACGGATACGACAGCAAGAAATGGAGACAACTATGTTTACCCACCTGTCCATGG
AAAGGGTGATGAAATTTAGGAAGTACTATAANGANAAATTCATAGNACACAAAAGGGCAA
GACTTTTGATAAAGGNGGCAACTTNGACCCTGNNTTGGTNCNNNGGCAATAATACNTTNG
AAAAAGGNTANCGGTTAAAGTATTNNCCAAAAGGNAAGAAGGTTCGCAAATGATTCCTTT
TNTTGTGAAGTTNAATATGGGGCTAGCTTTACACTNNCANNTTNTGACNGANAGCNGNGN
CGGCAGNAGGTNAGTAGAGGNTTNGNA
Quality >S03036-01_K01.phd
2 3 2 2 3 4 3 2 3 2 3 4 4 2 5 8 6
6 6 6 5 7 8 5 3 5 3 3 5 9 7 15 22 14
24 14 6 21 21 7 9 29 26 13 6 14 7 23 29 37 18
21 26 35 21 21 30 43 17 5 22 24 17 11 29 29 13 23
15 41 31 33 32 26 19 32 24 44 31 36 41 48 48 48 24
30 26 26 30 20 36 47 44 31 37 49 35 31 18 39 27 50
35 46 31 29 46 46 38 37 37 25 30 14 26 15 29 39 26
27 49 49 37 29 26 49 47 33 43 43 43 43 43 43 39 28
37 35 35 35 49 49 49 39 51 35 51 32 46 30 30 30 51
43 42 35 49 21 49 33 53 46 42 51 46 42 30 43 42 39
37 51 49 42 46 43 42 44 53 43 34 42 39 31 50 44 59
57 53 49 54 27 54 50 57 63 60 54 63 63 44 49 50 44
54 54 54 45 47 46 42 49 46 42 52 44 34 58 60 57 52
60 47 52 52 35 34 60 25 57 57 52 42 57 47 52 60 47
48 43 40 29 60 48 30 30 43 52 57 63 53 48 40 48 57
52 63 60 58 42 32 57 57 60 63 57 46 46 52 41 60 57
48 35 42 63 63 47 60 52 63 42 42 52 57 40 47 47 52
52 44 63 52 42 63 63 63 35 52 46 52 41 63 42 63 63
60 63 53 48 40 48 47 41 42 29 57 46 63 43 44 29 57
47 47 44 46 47 34 52 57 60 47 44 63 44 46 39 46 34
58 42 47 47 44 47 27 35 45 42 47 58 58 27 29 39 33
43 35 47 16 33 22 42 42 25 33 58 60 63 53 53 22 35
22 31 31 17 16 28 15 9 18 35 29 17 20 28 42 31 57
31 31 59 57 57 30 31 30 29 30 22 54 57 17 9 17 27
24 19 33 22 33 11 7 13 21 18 21 34 31 9 42 51 35
24 35 57 21 35 22 32 40 22 30 22 34 35 35 27 27 43
33 21 52 20 17 51 33 28 28 26 23 41 17 46 28 18 49
16 30 41 30 51 18 30 17 40 24 49 49 49 51 52 49 28
26 23 13 49 34 31 20 26 47 11 50 19 50 20 50 19 28
31 21 28 51 49 13 38 29 30 28 27 17 30 22 34 26 51
27 49 30 40 30 27 52 21 14 7 10 36 16 29 19 9 27
18 14 18 51 51 50 18 28 50 50 50 28 18 27 28 24 27
27 48 45 50 28 33 9 42 21 15 25 15 35 31 14 41 18
48 13 7 26 23 15 26 29 29 31 14 26 29 28 18 20 23
23 23 35 41 26 14 31 22 30 47 47 47 35 14 16 15 13
10 31 18 35 44 16 19 12 12 38 26 26 20 9 40 35 22
21 28 27 20 29 26 27 27 21 9 33 24 16 34 12 8 21
34 21 17 12 16 18 15 12 27 19 34 22 28 29 29 11 19
26 9 20 17 23 29 29 14 12 26 11 28 19 47 12 29 35
11 29 14 36 23 20 11 25 28 40 24 12 33 31 17 12 31
21 13 16 16 13 20 15 16 33 9 10 6 15 11 7 25 31
13 24 24 8 18 27 18 16 7 17 14 13 28 14 28 33 27
10 42 27 10 10 20 31 8 27 17 24 28 33 20 20 21 13
17 15 19 19 7 13 16 21 11 22 21 10 22 7 9 9 16
30 12 12 25 7 6 10 9 12 16 14 6 9 6 6 7 19
16 14 14 27 8 26 17 16 13 12 7 23 28 6 8 10 19
23 30 26 15 17 6 9 18 7 12 14 27 21 8 27 29 28
14 9 24 15 13 7 6 25 27 9 26 45 25 15 18 6 15
25 21 27 29 27 31 8 19 13 8 20 15 37 20 13 18 9
11 15 29 13 18 25 19 10 6 13 22 25 13 29 11 10 10
18 27 7 16 23 13 18 15 26 15 27 31 19 9 17 18 16
14 18 21 11 10 16 17 13 7 6 10 18 6 6 9 9 6
9 10 11 13 6 9 11 7 10 9 9 7 14 6 10 6 9
16 33 10 12 17 7 9 9 14 14 7 11 23 18 9 12 9
10 9 6 12 10 6 8 7 9