S03036-01_K02
Seqid S03036-01_K02
Sequence >S03036-01_K02.phd
NNNNNNNNNNTNTNNANGGCNCNANNNNNAGGGNGATTGGCGGCCANATCGGCCGAATTG
AAGGATAACAAACATCTTCTTTCGTTCGCTTCAAAATAACTACAAATTAAAAATGCAATT
CTCTACCGTCGCTTCTATCGCTGCTATTGCCGCTGTTGCCTCCGCCGCTTCTAACATTAC
CACTGCTACTGTCACAGAAGAATCTACCACTTTGGTCACTATCACTTCCTGTGAGGACCA
CGTTTGTTCTGAAACAGTTTCCCCAGCTTTGGTTTCCACTGCTACCGTCACCGTAAATGA
CGTTATCACTCAATACACCACCTGGTGTCCATTGCCAACCACTGAAGCACCAAAGAATAC
CACTTCTCCAGCTCCAACTGAAAAGCCAACCGAAAAGCCAACTGAAAAGCCAACTGAAAA
GCCAACCCAACAAGGTTCTAGCACTCAAACTGTTACCTCCTACACTGGTGCCGCTGTTAA
GGCTTTGCCAGCTGCCGGTGCTTTGTTGGCTGGTGCTGCCGCTTTATTGTTGTAATTTAC
TCAACCTTTTCTTTAATATATTTTTAGAAAAATGGTTAAGTACTTTTCCGTCAATACAGC
TTCCACAAAATCCTTTTATTTCAATTAATAAGATATTCTGGTAATTTCTTATTCTAATTC
TAGGAGGCAACAACTCCATAACTAAATGGTTATTATAATAAATNNNNATATAAAGNAATA
TCTCTTANGNTNCACGCNACTAAACTTNNNTTATATNTNGGGAGCGGAGTGTGTAGTCTA
NTNANATAAAAAAANNNNAATAANAAAANATAGGTNNNGNNNNNGGGCCAGNCTGNAGGN
ATCNNNNNGNGACNNNAANAGNNTNGNNNAACAGGNGCNNAGNNTGTNNCNN
Quality >S03036-01_K02.phd
3 2 2 4 4 4 3 3 4 2 12 6 10 7 5 8 7
11 9 9 7 9 3 8 3 6 5 6 7 10 10 12 18 6
19 21 9 32 42 13 10 36 21 14 20 10 7 22 40 37 50
21 31 37 49 27 15 23 50 37 27 30 38 41 16 10 42 35
34 30 38 49 34 36 47 49 49 52 52 49 40 46 49 49 49
41 42 26 28 49 46 35 31 31 49 49 43 43 40 46 34 35
43 19 35 35 35 31 35 29 27 29 31 25 35 37 29 32 32
49 46 54 54 43 49 45 46 43 49 54 54 51 53 30 45 42
42 51 51 50 50 43 49 50 42 42 50 49 49 50 54 54 54
50 50 54 54 50 43 51 57 50 51 51 57 54 51 51 57 57
50 41 42 51 49 49 53 51 49 52 50 42 52 50 50 54 43
54 54 57 53 51 49 54 54 49 43 53 53 42 53 45 35 49
51 49 51 43 40 49 53 46 51 52 50 49 50 43 42 47 50
49 50 36 50 49 50 49 49 49 52 41 52 42 31 49 31 25
37 37 36 43 46 40 32 46 36 49 49 52 52 50 52 51 52
52 52 52 53 49 43 52 46 45 46 49 49 49 51 51 50 50
46 52 49 46 49 35 50 49 51 52 50 49 36 53 52 52 52
52 46 49 52 49 50 51 53 52 52 52 33 50 49 52 46 50
51 46 49 49 43 32 50 50 49 50 42 50 52 40 51 52 49
53 53 46 49 35 46 52 41 51 53 49 40 52 29 52 51 51
38 49 50 42 43 50 49 51 40 35 49 28 52 52 49 50 49
30 50 42 52 50 52 52 52 50 52 42 51 41 50 51 52 34
49 32 51 40 52 51 53 53 51 49 50 35 49 28 49 36 40
36 50 49 49 49 42 29 49 41 49 35 46 51 50 47 53 49
32 41 49 30 52 42 51 49 44 51 51 52 41 31 49 28 52
46 49 49 34 51 42 29 52 46 53 32 53 34 42 42 49 37
42 41 50 32 28 53 52 42 50 50 34 49 32 32 50 50 32
49 36 46 34 30 41 50 46 53 46 37 30 32 31 42 47 35
31 47 29 46 26 34 27 46 53 43 31 27 49 31 30 35 49
35 20 39 37 49 26 49 35 32 50 46 39 17 49 43 49 30
46 37 49 31 32 35 41 36 35 42 26 28 28 28 37 26 20
49 35 15 43 34 17 18 31 16 43 37 35 32 40 31 10 30
15 30 23 41 41 41 33 21 43 44 14 42 30 32 28 26 33
28 22 16 20 28 32 37 45 15 17 41 22 42 37 18 36 26
23 13 24 13 20 33 30 32 28 12 15 13 27 29 12 41 26
28 36 16 29 36 28 39 13 14 13 23 16 29 18 21 25 16
29 15 21 10 21 28 28 23 40 26 15 13 13 33 16 37 30
28 33 17 30 15 15 18 45 22 13 15 14 16 19 13 13 16
14 18 17 45 27 28 14 29 21 9 32 15 35 25 18 19 19
26 31 24 36 15 19 21 14 9 21 25 27 9 29 16 30 30
28 22 24 15 41 12 8 29 10 33 31 19 14 25 26 21 11
37 30 22 34 18 20 7 3 5 7 38 9 8 11 10 26 11
10 7 9 30 9 20 14 11 26 26 9 14 12 5 8 5 13
7 23 15 21 10 27 7 21 19 16 12 31 27 23 13 13 5
3 7 23 10 13 28 18 24 5 20 6 10 11 10 29 26 8
20 11 18 16 10 11 8 11 10 10 9 18 9 15 13 6 12
7 13 6 11 9 11 12 10 17 11 14 15 5 6 6 6 23
11 10 9 10 5 12 10 12 14 5 27 11 21 19 15 14 7
5 7 9 5 7 5 5 7 8 14 12 11 15 10 16 6 10
15 8 7 9 16 8 7 9 26 9 5 5 5 5 7 10 6
9 9 9 6 5 5 23 24 7 15 9 7 5 10 7 12 6
5 5 11 13 11 9 9 9 6 11 9 5 3 8 11 7 6
12 15 9 5 7 11 6 5