S03036-01_K03
Seqid S03036-01_K03
Sequence >S03036-01_K03.phd
NNNNNNNNNNNNNNNNNNNNNNANNNNANGGCGATTGGCGGCCAATCGGCCGATTGACCA
AAAATTATTGTCTAGCTTACTTTCAATAACTTATAGCTATCTATACAAAAATAATAATAT
AACTAAAGTCAGGCCCAAACCAGGCAAAACAAAACCATAATAATGGGAATTATTACACTA
TCCGGCAATGTTCTACATTTATTGAAAGCCTACCCAAAAAAGGGCCTTGAAGAGGTTTCT
CAACCAGAGCCTAATACAGCAAATGATTCCTCGACTGAATATAAAGGAAAAAGCAAGGAT
GATTTTCAAATGGTCGAAAAATCCAATACAGATGAGAGATACAATTTTACAAGAACAAAA
AAATGGTTTTTATTGATGACCTCAGAATATTACAAACTAATGGAAAACAGACTTTTAATG
TTTTGCATTATCGCTTGCTCTTTTATTTGTGCTATCCAATTTCTTTTCTTTATAATTTAT
TGGACCAACATTGTTCCACGGAAGACGCAAAGGGCAATAACTAACCTAAATTACGATTAT
TTAACAGCCCATCTAAAAGAGCAATGCGTTCCATATGCGAAAATTCTTGACCAATGTATT
CTCTAGCAATCTCTGCNNTTGTACATTCGTAGTTTTTTTCATGTTCCCTTTCATAAATTA
ATAAAAAAAAGCGTANTCTTTTTCNNNNNNNNNTANNAAAAAAANANAAAAAAAAAAAAA
AAAAAAAACTCCCTCTCNNGCCATANNGNCCAGCTTGAANATTNNATAGGGNACCCTAAA
AAGCTTGCCTAATAAAGGNNAAAAGAGTTTCCNGNTGNGAATTGTTTTCCGCTCACATTT
NCAAAAANCGACCAGCCCGCAACCATCANGNNNANNNNCCGGGCGGCGNNGGGNGGAGNC
ANCNTCAATTATTTTCNNTACGCNNCAN
Quality >S03036-01_K03.phd
6 5 5 5 4 6 5 3 2 3 3 5 4 2 2 4 5
5 5 3 5 7 10 3 5 3 5 8 7 19 27 17 26 25
10 31 25 10 11 32 23 12 14 14 26 37 36 35 25 29 32
32 25 9 33 31 13 12 23 25 33 32 33 42 20 32 39 31
40 50 45 48 33 34 50 45 49 33 43 34 34 36 29 27 15
13 26 36 36 41 37 28 35 32 27 21 33 25 35 37 49 37
35 42 35 45 31 26 34 35 35 35 43 46 52 52 52 54 54
59 54 49 49 51 42 49 46 54 54 59 38 46 43 37 50 50
42 49 49 54 52 42 54 51 50 59 50 47 45 43 46 43 43
43 42 47 44 51 49 46 46 49 49 49 47 43 46 42 43 44
49 43 45 45 49 49 42 50 50 44 49 49 49 54 63 50 49
63 60 63 63 43 41 42 60 60 47 63 63 63 60 58 63 63
45 47 49 51 49 51 50 57 52 60 63 42 58 60 57 60 57
52 63 52 52 58 60 58 52 41 41 46 52 52 52 35 48 43
43 48 57 60 57 60 58 52 57 63 52 63 63 53 57 57 57
57 60 47 57 57 60 57 58 58 63 53 52 63 60 63 57 60
57 52 52 57 58 58 58 57 57 57 57 60 57 57 63 58 58
60 57 57 52 59 60 57 63 63 52 52 60 52 52 63 63 63
52 46 54 57 57 63 63 52 53 57 53 63 63 63 48 48 60
53 57 63 57 60 60 52 60 57 52 60 58 57 57 57 52 46
52 57 60 57 57 60 60 48 48 57 47 57 60 52 60 48 57
57 60 48 48 48 43 48 60 52 44 60 57 63 52 60 52 58
63 47 52 63 52 39 52 57 57 47 52 52 57 60 52 42 63
52 60 47 58 63 57 57 57 57 57 63 63 52 63 63 63 47
40 46 52 44 60 57 60 52 57 52 60 49 31 51 60 43 51
44 44 49 51 60 50 60 50 42 60 58 43 22 44 60 60 60
58 54 50 35 54 60 49 35 52 47 50 47 44 54 54 44 54
42 54 54 42 35 46 46 42 39 31 54 54 31 59 31 50 42
59 59 46 44 59 54 42 42 21 42 39 39 42 39 42 43 54
20 46 41 54 44 42 54 57 42 43 27 41 17 54 54 39 50
54 44 59 54 39 44 50 42 27 54 42 42 34 59 29 59 38
37 51 35 35 35 35 32 32 54 19 54 54 28 42 43 30 43
35 30 46 38 42 42 30 35 35 46 22 44 35 47 40 42 30
43 35 43 30 49 19 36 37 37 30 49 30 33 35 35 35 28
41 49 41 35 30 19 46 30 22 35 46 16 12 12 22 32 34
36 17 26 26 35 28 19 41 27 28 26 28 13 18 17 27 12
16 16 26 21 7 6 9 28 30 13 11 17 14 18 30 28 28
19 30 17 10 32 32 32 32 49 15 14 12 18 13 13 14 11
16 10 28 34 29 28 20 20 15 27 27 9 8 35 17 11 39
49 49 40 37 40 46 29 20 25 29 23 17 6 29 27 16 21
36 31 22 13 3 6 3 5 7 5 7 5 7 8 8 7 7
12 18 15 15 17 21 13 3 15 5 8 12 17 14 22 27 20
29 22 16 19 19 18 9 28 30 31 23 36 9 12 11 11 13
11 13 11 9 8 12 7 7 12 15 27 17 18 13 7 7 11
6 11 12 10 20 11 11 8 17 9 8 6 13 9 10 7 7
10 10 12 15 16 18 6 9 9 18 10 15 13 26 13 10 16
15 11 24 23 25 11 9 13 35 16 8 17 14 15 13 17 6
6 10 21 19 20 18 14 20 13 11 17 18 13 7 9 7 11
21 5 9 14 31 24 19 8 17 17 13 11 11 10 9 15 18
22 28 18 19 9 19 17 7 8 16 9 12 18 16 7 10 10
16 11 9 17 11 15 26 21 12 11 16 10 28 27 13 11 15
13 6 9 7 7 7 11 6 6 6 7 10 11 26 26 13 9
8 12 17 12 7 7 11 17 20 7 15 12 10 16 7 9 9
6 9 6 10 13 12 12 11 28 13 8 26 31 11 12 6 6
12 11 16 11 9 6 6 9 8 6