S03036-01_K04
Seqid S03036-01_K04
Sequence >S03036-01_K04.phd
NNNNNNNTNTNTTTTNTNCNTNCNANCNANNAGGNGATTGNGCGGCNNAATCGGCCGAAT
TTTTCGGACTTTGGCTGGTATTTAAACACAAGTAAGAGAAGCATCAAACATGGGAAAGAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGGTACCGGC
CATAAGGGCCAGCTTGAGTATTCTATAGTGTCACCTAAATAGCTTGGCGTAATCATGGTC
ATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGG
AAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTT
GCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGG
CCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGA
CTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGNGGTANCAGCTCACTCAAAGGCGGTAAT
ACGGTTATCCACAGNNNCAGGGGTTTACGNTGGATGGAAANTGTGAGAAAAAGCCAGGAT
ANCNNCGACNACCNTCGAAGGCCGGGTTTGTGGNATTANTTCATAANTTCACCTNAAAAC
AAAGAANCAAAAANNGGGGNCAANTCNAGGTTGGGTGATAANAAGNAATAAANAATTCAT
TGACTTCCCCCTGAAAGGGGAGGGGGAGGAAGTAANTTTTTTCTTTTTCTTATCTAAAAC
AATACNAATATTNNTCTCTGAGAAGTTTTGGTTTGATATANNAAACATAAAACTATCTAA
NNTNCTATCAACTGNNGCATACAGAAAGGGGAGAGAACATNGACNCN
Quality >S03036-01_K04.phd
6 4 3 3 6 6 7 8 6 10 6 13 10 8 8 7 9
7 9 6 9 5 8 7 9 5 10 5 12 7 7 8 15 15
5 8 8 16 21 32 6 13 10 30 15 9 5 6 10 22 42
42 41 34 36 35 31 26 9 27 49 49 49 35 35 32 42 18
21 46 54 30 24 23 21 44 43 54 29 39 38 50 38 30 30
30 44 27 39 12 16 32 44 35 34 27 34 27 32 27 27 42
28 39 42 34 39 42 42 31 39 44 53 38 25 29 35 27 28
10 18 20 35 29 29 22 29 22 22 22 15 27 29 16 16 15
12 17 12 9 16 13 12 13 16 11 16 9 19 21 19 24 13
34 33 17 33 30 37 37 46 35 37 35 35 35 35 32 32 24
15 10 28 30 21 35 35 35 46 49 28 20 35 34 30 35 49
31 42 43 31 28 32 36 36 30 22 27 26 27 31 32 32 28
29 27 30 21 22 36 28 37 21 42 46 36 42 40 36 41 26
21 28 33 30 37 32 32 36 42 42 24 29 36 12 17 34 42
21 32 34 30 31 28 17 21 30 41 49 43 42 34 32 42 41
50 32 35 30 29 32 31 33 25 28 28 28 29 34 35 25 23
27 28 28 40 26 30 40 40 42 42 20 50 30 35 46 46 36
36 40 42 37 35 42 34 40 36 32 30 35 36 34 34 30 36
36 40 28 29 30 36 42 36 49 34 30 35 36 30 49 46 36
36 32 38 35 46 41 46 36 28 34 30 28 34 36 35 34 35
35 32 35 28 28 28 26 34 24 36 46 28 21 32 37 36 29
31 36 30 30 26 32 32 32 41 28 21 23 34 35 35 31 43
37 52 49 40 35 35 18 46 43 41 50 36 25 22 26 31 33
32 35 43 32 35 24 30 42 36 37 22 21 35 35 35 46 26
43 35 29 31 15 30 35 27 28 54 30 27 32 37 35 32 46
32 35 27 39 30 34 31 25 29 26 31 30 42 32 33 31 33
49 42 35 33 22 28 19 38 40 46 21 21 11 42 34 38 27
42 39 30 20 12 23 29 32 27 25 22 27 28 27 34 19 23
20 27 22 23 28 32 27 25 26 32 27 33 18 30 39 35 35
33 27 35 35 13 13 27 35 42 29 32 24 31 22 33 17 21
20 10 7 9 9 12 8 7 9 14 10 16 20 12 12 16 18
12 10 40 36 21 28 21 19 27 19 25 23 19 9 11 34 39
14 13 12 12 21 28 12 21 16 9 7 6 6 11 14 17 42
52 11 12 11 9 12 17 9 6 9 10 9 16 8 8 8 13
16 12 7 14 12 18 17 12 9 12 20 22 12 9 16 23 26
10 10 9 9 8 10 7 9 6 7 28 14 9 10 6 13 20
12 6 10 13 8 13 21 25 20 11 16 11 11 16 22 10 10
9 9 18 9 6 11 16 16 10 6 11 11 14 14 13 16 12
6 13 17 10 17 15 15 9 6 9 11 14 20 14 16 24 14
11 11 8 7 17 29 20 12 19 11 6 7 10 13 15 9 6
9 14 9 7 14 10 7 8 11 22 9 11 16 16 9 9 10
11 9 14 12 6 11 12 9 6 9 9 15 15 9 21 7 16
19 25 15 27 14 21 10 10 13 14 17 16 20 19 17 20 17
17 16 17 16 17 16 13 22 17 14 20 20 17 18 12 13 10
9 13 9 10 9 11 11 7 12 13 19 25 13 9 11 13 20
25 15 21 19 22 11 11 10 8 10 10 12 9 17 17 9 9
9 16 12 6 10 13 14 16 14 8 6 7 10 11 11 8 13
15 10 10 8 14 13 9 12 9 16 16 12 24 17 21 11 13
26 11 19 12 7 6 16 16 16 11 18 11 13 15 9 18 13
15 18 12 16 21 13 8 7 7 10 7 8 17 12 13 11 12
8 11 14 11 7 7 10 8 15 13 20 8 19 17 17 11 21
15 17 11 15 23 19 19 21 18 12 14 14 10 7 13 11 9
7 9 7