S03036-01_K07
Seqid S03036-01_K07
Sequence >S03036-01_K07.phd
GNNNNNNNNTNNNNNCCCNCGNNNNATANGGCGATTGGCGGCNNNTCGGCCGATTCCCAT
GGGGATCCGATTGAAAAGTTGAAGTTGTTTGGCACTTGTTTCGTGCTTTCTCAAATATCT
TAGATCACCGTCTGTCTAGAGCATATATCTATTGTTTGACGCACCCCTTTTACAAAAAAA
AAAAAAAGAAACAGATCTATTAAGTAATAAAAAAGTTATTTAGGAAATAAGGTGCAGTAA
GCTTCCTGAGGCATAATCACTATACTTTTAAAATCTATATTTTTGGGTTATTGTTGAAAT
ATTTTCTTACAAAGCCCATTTCTCGTTTTTGACAATTTTTCTTATCAGTTGTGGCTTCTC
TTATCGATAAGCAATATTGAAGTCCTAATCACAAAAGCAAAAAAAATCTGCCAGGAACAG
TAAACATATGGTTTTGGAATACCAACAAAGGGAAGGTAANGGATCCTCATCCCNCACCAT
GCGGCCTGAGTNNTCGNNNCGACTATTCANNCATGCTCTGAAGCAANACTGGGAAGGGCG
CGGGCTGACTTGANCCTTATCTATCAGTATTGNAAAAGATGAGNAAAANACGNNGCCCCN
NNNTNGNGAGNGGGGGGNGGNGGGGGAGGTNTANGGNTTACACATTAAAAAAANAGNGNA
AAAAATAACGGTNTTGCTCTTNNNANGTTTTTATTATCTTANAAAAGNAAGAACATATCT
TGCANTAACTGGNNNGTGNTCAGGGGAAAAGNGAAGNNATTATAAAATANNNAATTTAAT
TNNTNNAANNAAAAAAAAGAACAAGGNNNNNTGGTAAGAAATAATNNNAAAAATAATAAA
GANAACGCNANNTAGACGGGGGGTGNGGGGNNGGGGGNAGGNNGGNGNTNNGATGTNNGG
NNGGTAN
Quality >S03036-01_K07.phd
12 7 4 3 3 2 2 3 6 11 5 5 4 6 5 8 10
8 5 9 9 6 5 5 3 21 11 10 6 10 18 8 17 14
9 9 21 12 9 25 17 9 5 5 6 27 25 30 26 26 23
16 15 9 22 11 11 14 13 25 24 35 31 36 16 14 16 21
22 33 17 35 35 17 15 29 24 31 28 35 42 19 15 23 28
30 41 31 35 40 41 24 30 16 29 28 29 49 32 30 26 26
32 28 42 27 29 29 26 32 31 35 31 31 37 37 46 42 46
52 43 49 30 42 42 43 37 42 49 50 46 49 46 51 54 51
43 42 47 42 49 49 54 49 49 54 59 50 54 50 54 49 51
53 50 53 53 53 42 31 50 50 54 50 50 49 49 49 51 51
44 39 49 44 43 46 49 49 50 49 49 54 59 54 60 60 63
60 58 60 50 54 50 49 63 50 54 50 60 50 50 49 60 43
47 50 50 50 60 57 57 57 60 46 52 57 57 60 52 60 52
52 57 57 44 43 40 40 32 23 40 52 27 28 20 21 35 27
23 11 23 52 57 48 53 53 53 63 52 46 52 60 57 57 57
57 57 57 57 52 52 57 63 60 63 63 60 60 52 57 63 63
57 57 57 63 58 60 58 63 60 63 63 63 63 63 58 57 57
57 52 60 58 52 60 63 58 63 60 60 57 52 60 57 57 60
57 52 57 57 60 52 60 57 57 57 57 57 48 60 58 57 57
57 58 57 57 60 48 57 57 52 52 60 60 52 57 57 57 57
60 57 52 57 57 52 44 44 47 47 47 22 47 52 28 47 37
30 22 21 23 28 37 30 32 42 60 60 60 57 60 57 60 60
48 48 52 47 47 42 40 34 39 24 24 20 30 30 47 35 23
35 37 42 57 57 40 60 46 52 57 57 48 48 48 43 34 60
52 52 32 35 42 40 34 35 40 40 24 40 46 39 41 37 41
26 30 18 29 24 19 43 48 43 40 40 32 23 23 30 35 35
22 24 26 35 34 11 34 30 43 35 52 52 24 46 20 25 24
7 10 19 9 12 14 12 13 18 12 25 10 9 9 7 13 10
14 22 9 14 17 10 9 16 9 9 9 18 16 13 9 7 7
11 11 22 6 5 7 14 17 37 28 46 24 27 14 12 9 7
6 10 13 21 13 11 16 14 18 12 35 12 13 12 8 9 7
14 18 15 18 9 9 8 13 11 9 11 9 11 8 11 16 27
23 11 9 19 13 12 15 28 10 6 13 18 17 14 11 31 15
18 12 27 21 9 19 9 11 9 16 9 6 16 22 11 13 9
9 11 10 10 9 6 12 12 13 11 6 11 9 16 6 6 8
9 9 9 9 6 7 6 6 11 6 10 6 9 11 9 7 14
19 16 14 9 9 6 8 11 6 11 11 31 10 9 17 11 10
9 6 14 9 6 9 9 6 9 23 8 9 11 11 9 9 10
11 11 10 12 14 15 11 6 19 10 6 9 6 12 26 11 11
27 16 8 11 11 8 8 9 9 7 11 9 9 9 16 11 11
10 6 6 6 10 6 8 18 10 15 22 11 8 11 9 9 10
12 11 8 9 6 16 14 11 9 9 7 11 11 8 12 11 9
11 10 11 9 11 10 9 8 10 10 6 9 9 9 12 10 10
10 6 6 6 9 9 11 6 8 9 11 10 8 12 11 9 10
9 8 9 6 9 10 9 9 6 7 9 11 10 10 10 11 11
10 9 11 9 6 6 6 9 8 9 9 14 9 9 10 11 6
6 10 7 5 11 9 7 6 8 14 9 10 14 18 12 9 10
11 13 8 9 9 8 9 6 6 6 6 6 8 10 9 9 10
8 10 13 10 9 8 11 10 10 7 5 5 9 28 28 10 9
11 11 12 8 11 8 9 14 17 5 13 10 10 11 9 6 8
6 7 10 11 10 10 10 9 11 11 9 10 9 9 9 6 8
9 10 12 6 5 8 13 9 11 11 7 10 9 10 6 6 8
12 6 10 7 14 5 6 10 10 14 8 9 6 6 11 9 5
5 10 9 9 11 5