S03036-01_K08
Seqid S03036-01_K08
Sequence >S03036-01_K08.phd
GNNNNTNNTTTNTTCAGGCCCNAGNNATGGGNGATTGGCGGCCAAATCGGCCGAATTGGA
CTATTGGAAATAGCGAATCAACAACAGCTAACGAACGACTAGGTCTCTAAGAGAAAAAAT
CTTTTTCTTTTCACAACATGGAGCAAATATTATATAATCAAAGCCTTAAAATTTCTACCC
TTTCTACTTTTCAAGGTTTAAAGTTTCTAAAGGTCCTCATTTTTTCTATTTTCCAACAAC
TTTTTTATAACCCAGTTATACAATTATTCGGAACGAAAGCCTCAATAATGGAATCTGATT
CCACTACTCTGCTCGAAAGTAGTTGGAGTACTGAGCGAAACTTTCTCAATATGAATCCAG
ATTCCATATCTGCTAGCAAGAATGTTTTTATATTATTTTTTACCATTTTCAGATTAGCGG
AGTATATTGTATACAAACTCTCTGACCAGAAGTATCGGTTACACACATCCCTGAATGTCC
AACATTTCAGGTGGAATTCGAAGAAGAATACAAACAGAAAAAGGACACTTTCCTTTAGCA
AAGCTTACTTACCAAGAACAAATATACTACCGATTTTTNTAGNCGATNGACNAAAANNCN
CTTCCCANGCCCGCNANGTGNAGANNGGGTGGAGGTGNCAGNNATTTTTTNTATTGAGAA
TAANATATTANGCGGTAGGGGTGNAACGGGAACTGAATAGTTGTNGAAGCCGGANNGGCC
CANNCATCCCACAANATGCCCGCAGNANGAGGNGAAGGGGGGGGTCGGAATNNTTTANAA
ATTANAAAAGATANAGGAGGAGAACAAAGTATGGGCNGTCGCTAGAGAAAAAAAAGTGNT
ACANACTANNANCACGNAAAGNACATANGNGNNACCNGGAACAAAAAGTNNGATNTGATA
TGNGNANAN
Quality >S03036-01_K08.phd
8 6 5 2 3 11 6 4 12 12 12 6 11 12 10 9 14
9 12 9 13 7 8 8 7 5 16 9 10 8 8 6 22 26
17 18 20 15 9 25 28 11 13 9 8 12 36 28 40 22 30
30 28 24 9 29 30 26 17 20 11 28 33 34 30 40 27 19
16 15 26 35 30 30 32 35 35 27 28 32 29 35 25 27 44
17 19 30 38 38 42 38 31 35 36 36 19 26 28 34 36 38
38 44 39 39 35 35 21 22 18 30 28 31 35 24 26 24 27
27 34 34 34 47 47 52 57 57 60 47 52 52 44 57 44 57
52 42 47 41 43 52 52 57 52 46 52 57 48 52 52 60 47
47 47 47 57 57 52 52 60 57 48 41 47 47 35 47 47 42
42 52 60 60 57 52 52 57 60 52 60 60 52 57 52 47 52
60 60 60 57 52 47 52 63 58 48 43 48 57 57 57 58 60
60 48 53 48 52 60 60 52 52 47 52 57 52 60 47 57 60
60 60 60 59 57 47 57 57 60 48 40 47 30 27 27 29 22
28 25 23 23 47 36 36 32 47 57 42 60 60 57 48 52 60
60 53 47 48 40 57 42 40 43 53 43 48 48 60 52 52 53
48 48 48 63 63 48 57 52 60 57 52 57 60 57 48 43 48
57 52 57 57 47 60 48 57 52 46 48 48 43 35 52 52 46
57 48 60 48 43 48 57 57 57 52 48 48 48 41 48 48 43
46 57 58 60 52 60 44 40 60 60 52 52 57 52 57 41 40
43 40 40 40 41 47 44 22 35 41 47 52 52 47 43 44 44
42 22 47 52 40 47 43 40 32 43 43 43 57 57 52 52 42
57 57 52 46 52 60 63 43 52 52 52 63 63 63 45 47 60
42 52 63 52 52 60 43 60 57 46 42 47 42 35 47 60 60
57 52 42 57 44 28 45 35 42 52 46 47 41 27 43 57 46
52 52 57 45 52 57 47 47 52 23 40 35 35 40 47 60 57
60 57 52 35 52 27 40 35 41 47 60 52 42 60 40 35 29
43 35 40 35 60 47 35 14 37 40 40 40 35 35 25 15 23
35 31 32 29 19 35 34 35 35 35 32 32 29 16 41 12 42
21 12 21 28 33 19 14 13 25 18 13 9 9 21 42 39 35
40 12 14 16 35 35 34 29 22 28 14 23 23 32 27 25 30
35 47 41 34 27 23 21 20 16 27 29 24 16 8 10 18 23
32 27 41 22 24 41 24 29 20 19 32 33 16 22 15 11 28
30 42 29 37 24 37 26 28 16 16 11 19 12 11 16 14 23
6 9 32 18 6 12 8 24 9 6 12 17 9 6 18 34 20
18 7 6 9 7 11 8 19 28 11 21 10 6 12 8 9 19
19 11 6 11 7 11 9 11 7 8 9 11 6 6 10 14 14
9 11 14 9 10 10 8 8 6 14 12 10 6 6 11 13 20
11 9 10 12 6 11 11 20 24 13 19 13 10 11 9 10 9
7 14 10 18 15 12 11 7 9 11 11 9 12 12 11 9 8
11 11 10 6 19 11 11 11 19 11 12 11 11 14 11 14 13
12 19 15 10 9 10 9 6 10 9 9 9 10 9 9 11 10
6 7 22 28 15 11 10 9 6 6 10 11 10 9 9 11 10
11 12 19 6 9 8 23 9 10 9 12 10 8 9 6 9 6
8 8 8 14 6 14 8 8 11 11 12 12 11 11 11 9 28
9 14 12 11 23 10 6 6 14 19 8 9 7 10 9 13 13
10 34 6 9 16 28 28 21 20 11 9 6 19 10 13 17 10
10 16 12 14 13 13 10 15 11 11 13 10 9 10 14 10 9
6 9 11 10 9 14 10 9 9 8 11 16 9 14 14 22 14
10 11 9 11 9 6 11 8 9 12 7 9 8 11 9 6 6
8 6 8 9 9 9 6 9 8 9 9 6 8 8 9 11 8
6 11 6 10 7 6 9 10 10 6 8 17 10 8 9 11 11
9 8 9 11 10 6 6 14 8 9 6 9 9 11 9 9 11
10 5 9 7 11 6 11 5