S03036-01_K09
Seqid S03036-01_K09
Sequence >S03036-01_K09.phd
NNNNNNNNNNNTNNTTGGNNNANNNNNNTANGGCGATTGGCGGCCAATCGGCCGAATTGA
CTTACTACTTCACGATATACAGAAGTAAAAACATATAAAAAGATGTCTGTTTGTTTAGCC
ATCACAAAAGGTATCGCAGTTTCTTCTATAGGCCTCTACTCTGGTCTTTTGGCTTCCGCT
TCATTGATTACATCTACTACTCCACTAGAGGTTTTAACAGGATCCCTTACTCCCACTTTA
ACCACTTTGAAAAATGCGGCCACCGCCTTGGGAGCGTTTTCGTCAACTTTCTTTTGTGTG
AGCTTTTTCGGCGCTCCTCCCTCATTGAGACACCCCTACTTACTCTATGGTATGCTTGCA
GCTCCATTATCTTCATTTGTTCTAGGATGTGCCTCCAACTATCAGTCTAGAAAGTACAGT
AAAGTCTCTAAGGAATCTTCTTTATTTCCCGAAGACAGCCNACGCCCTGCTTCCGNACTG
AGCGATTCTATTATTGATTTAATTGAATANAACCATGCTTCAAGAAAATAAAAGGCNAGT
NGGGATTCCTGCGGGGATGACGGTATCNAAAACAGNAAGAAACNNNGGCAACGNTNNATC
NAANNNGACGAAAAAANAGAGTGNANAGNNGGTAATTGNATTTAAAANAAATACNAGGAA
GTGACCCGNACCGNGGGGAGATNGTGGGAGAAANAGGGNNGGTGTCTCAAAAANNTGCGG
NCAATNNNANGGGGATGGGAGAAANATTANGGGAGNGTCATNCNANAGTAATANTTGTTN
NTTTCTNTGGAGCNGTTGTAATCNCTGGATAATAGANACAGACACATCCTAACAGCGCCA
TGCNNGTCGNTACGANNTGTACNGGTGGGATTNGCCCNNNTNTAATAAAGNGNNNNNAAG
TN
Quality >S03036-01_K09.phd
5 4 5 3 3 2 4 3 4 5 7 9 6 6 9 9 9
8 5 3 5 9 5 3 5 7 5 7 9 9 5 12 24 14
22 18 12 20 33 15 13 30 14 10 18 23 24 35 30 31 28
31 30 15 22 9 15 36 26 15 14 31 30 26 25 26 28 35
41 46 30 28 33 33 46 34 32 34 34 40 28 32 32 34 26
19 15 16 16 22 21 37 21 33 17 29 15 17 17 21 18 32
31 20 26 20 20 14 25 20 19 19 33 32 35 32 32 35 46
42 33 49 49 44 49 46 39 42 36 36 35 39 28 44 44 44
43 50 34 49 46 49 45 43 46 49 44 46 49 54 50 45 46
49 49 50 45 60 44 50 54 50 58 49 50 54 60 60 63 43
45 45 50 60 47 46 46 50 44 46 41 47 47 54 49 63 45
44 51 60 60 49 63 63 63 63 63 58 58 63 63 63 45 47
50 44 47 47 44 47 50 47 60 50 47 46 46 57 35 44 60
52 52 57 60 57 60 52 42 42 42 47 36 29 29 46 60 60
44 44 42 39 42 44 57 60 60 52 52 52 57 60 57 57 42
45 52 60 52 52 52 47 52 60 57 57 60 57 57 52 57 57
52 52 52 52 57 58 63 63 63 52 60 57 52 57 52 57 60
60 57 60 60 60 57 52 52 52 53 57 60 60 57 57 57 60
60 57 52 60 53 52 57 57 52 57 57 52 57 60 52 57 43
40 57 57 52 52 42 52 57 46 52 60 60 57 52 47 52 42
42 47 40 28 47 35 34 35 48 47 34 37 37 47 37 35 30
40 41 29 47 42 46 42 57 41 42 42 41 60 57 60 60 52
46 52 57 57 52 48 48 48 43 52 42 40 48 52 40 47 42
47 52 52 52 48 29 18 22 47 45 53 35 18 28 45 60 53
53 41 45 45 39 45 35 42 45 32 47 14 11 12 23 30 35
23 35 39 42 45 45 45 43 20 32 26 35 36 35 34 35 37
53 60 39 45 53 20 33 26 26 41 20 14 15 26 22 23 16
10 7 19 10 10 12 9 25 20 25 18 14 11 23 45 10 7
9 21 16 22 18 16 13 16 24 12 34 32 32 41 40 46 42
41 45 53 28 35 18 12 8 9 13 12 9 9 17 11 12 6
9 23 12 26 14 33 30 19 14 14 9 22 19 11 19 18 12
30 14 14 8 9 9 10 9 14 6 9 9 8 6 19 35 42
13 9 11 19 23 19 16 16 12 19 16 12 11 11 9 11 10
9 15 9 18 20 9 6 26 28 9 9 13 13 18 7 11 18
11 19 9 9 11 6 6 6 11 11 10 11 11 14 8 6 11
6 6 8 8 12 6 21 14 6 6 6 11 11 11 9 11 11
8 10 14 8 6 10 11 14 9 11 19 6 11 6 8 11 7
6 15 14 11 12 9 11 14 10 7 10 9 9 9 9 11 11
11 6 9 9 12 9 11 9 6 12 10 8 9 13 10 10 11
10 10 11 9 10 7 8 10 8 8 6 9 9 10 12 15 14
11 11 6 10 13 17 15 11 9 9 21 14 11 6 10 9 9
14 6 6 9 11 10 11 14 15 11 10 8 8 10 8 12 7
6 9 8 10 9 11 7 9 12 11 11 6 6 7 9 6 14
11 12 11 11 8 16 9 11 8 9 11 10 11 6 10 9 11
11 6 9 9 10 11 8 6 9 9 8 10 10 7 10 6 17
6 9 10 11 11 32 10 28 7 11 11 9 9 9 7 6 11
19 9 10 11 6 14 13 11 10 11 9 6 9 10 9 9 15
8 9 9 11 6 9 9 10 10 9 9 16 9 9 9 8 9
6 9 11 30 11 19 9 17 13 10 11 9 9 9 9 10 11
9 9 9 11 11 10 10 10 9 10 6 7 11 11 11 11 6
8 11 11 10 9 7 6 8 10 11 11 8 6 9 10 9 8
14 11 11 11 10 6 11 9 11 9 6 7 7 9 6 11 10
10 10 13 13 12 9 6 8 6 6 6 5 6 9 11 11 8
6