S03036-01_K10
Seqid S03036-01_K10
Sequence >S03036-01_K10.phd
NTNNNNTTTTNNNNNGNNNNNNNNNNTAAGGNGATTGGCGGCCAAATCGGCCGAATTCCC
ATGGGGATCCGATATCAAGCTTGGGCCCGGTACCGGCCATAAGGGCCAGCTTGAGTATTC
TATAGTGTCACCTAAATAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATT
GTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGG
GTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGT
CGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTT
TGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGC
TGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGG
ATAACGCAGGAAAGAACATGTGAGCAAAAGGNCAGCAAAAGGCCAGGAACCGTAAAAAGG
CCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACCANNATCGAC
GCTCAAGTCNAAGGGGGCGAAACCCGACAGANCTATGAATNTACGANNGGTGTCNCCCAA
NAAGCTCCATNGTCCACCTCCAGTAANNACCNTGCCCTGNACAGATCNATNACCCCTTTC
NANATNTGGGNAGGAGNAAGANNGNANAGGANACNCTATNGCTCATAANANNGGGAAAAG
AGTTNNNTGNTAANGGTCANNGGATCANAAGNTGAAGCCACGACGAAANAAACGTTTCAG
NNNTGTCGTAGACGNGATTNCANAATGGNNGTCTAGTAATNCAGGNANGTTTACGANAN
Quality >S03036-01_K10.phd
5 8 7 6 6 7 11 11 20 12 2 4 3 3 3 10 7
7 5 7 5 7 5 5 5 7 9 9 9 14 29 7 18 19
17 28 37 15 17 44 24 25 22 16 22 31 44 43 52 31 41
46 42 39 22 26 48 41 41 30 20 51 52 52 50 51 17 16
50 52 51 44 40 42 30 30 50 52 51 49 49 49 51 45 28
50 52 52 49 52 50 28 34 51 49 43 49 42 28 49 49 52
50 53 44 50 43 42 49 49 51 49 52 54 54 57 52 41 57
59 52 57 54 53 57 57 57 57 57 54 57 57 57 57 57 57
59 57 57 59 57 57 57 52 52 54 57 57 51 51 57 59 59
59 57 57 59 59 59 57 57 57 59 59 59 57 57 59 59 59
59 54 57 57 57 57 59 59 57 57 57 53 57 59 59 57 53
57 57 57 57 54 57 54 57 57 59 57 52 50 59 57 57 54
59 57 59 59 54 57 54 57 57 53 51 57 57 57 54 50 59
59 59 59 59 59 57 49 53 54 49 46 46 50 50 46 49 57
57 53 53 51 57 50 57 57 57 57 49 53 57 57 57 53 53
54 57 57 54 51 49 57 57 54 54 59 59 57 59 59 50 57
57 50 57 57 57 57 50 50 52 54 54 54 50 59 57 57 53
57 54 50 57 53 50 54 54 42 57 59 59 50 53 53 50 53
49 38 57 57 57 54 54 57 49 51 46 51 36 54 57 57 57
54 54 47 54 54 53 50 59 59 57 46 59 59 44 43 45 35
49 54 59 59 59 54 54 51 51 57 42 29 42 36 42 31 57
50 38 57 57 47 38 50 54 46 42 57 49 43 45 42 52 47
54 43 54 49 43 49 50 43 49 49 35 45 49 46 54 54 54
54 54 36 49 54 42 32 54 54 54 54 54 54 54 54 54 50
59 54 49 46 54 54 37 51 37 54 57 42 54 54 43 36 44
33 49 43 35 37 51 49 35 36 32 35 54 43 54 57 54 54
42 54 43 30 53 42 35 50 35 35 49 35 46 49 35 43 46
46 50 25 46 41 35 40 41 22 49 32 35 47 49 40 43 27
29 42 23 37 39 20 42 41 35 35 43 43 21 45 32 39 49
30 50 49 35 21 34 54 43 43 54 28 39 21 20 30 43 24
19 7 34 28 33 29 13 29 46 43 26 38 11 38 26 12 21
21 17 37 40 26 26 23 42 17 15 21 42 43 23 33 42 34
17 14 22 23 30 35 44 42 20 43 31 31 14 24 33 24 30
42 42 37 22 33 9 12 16 11 17 17 35 35 35 27 24 19
33 32 29 9 29 12 16 42 42 35 12 19 9 12 6 6 10
14 18 12 29 28 11 12 14 22 18 37 16 9 11 6 11 12
14 36 9 19 22 10 13 37 28 11 14 27 12 12 11 13 9
9 9 6 11 13 9 20 10 27 18 8 6 14 18 14 8 13
6 7 11 10 11 11 9 9 6 13 33 12 11 11 6 9 23
10 11 18 11 13 8 9 6 9 14 9 11 9 8 12 16 17
12 10 12 9 9 8 7 6 28 16 9 6 14 14 9 9 10
8 10 7 9 10 10 12 30 13 9 6 10 9 6 11 14 9
18 14 18 11 14 9 7 8 6 11 9 6 8 9 19 19 6
19 10 10 10 12 6 11 10 9 11 6 6 10 6 11 6 11
9 9 15 7 9 8 6 11 12 11 9 6 19 10 8 16 11
10 22 11 7 8 6 6 9 8 18 9 10 8 9 11 9 26
24 9 6 6 6 10 9 6 9 11 12 7 12 11 13 12 10
6 6 9 9 8 10 9 15 7 24 10 10 6 9 10 11 9
9 9 11 9 11 10 9 10 10 11 11 11 6 10 11 10 10
8 9 12 11 10 9 9 7 6 7 11 10 8 9 9 9 11
11 10 11 9 6 9 10 10 8 6 9 9 6 8 8 9 9
9 6 7 8 10 11 10 10 10 10 14 11 9 6 14 9 9
9 7 11 6 9 10 9 8 10 10 11 9 6 10 6