S03036-01_K12
Seqid S03036-01_K12
Sequence >S03036-01_K12.phd
NNNNNNNNNNTNNNNNNGNNNNCNANNGGGCGATTGGCGGCCAAATCGGCCGAATTTGAA
TTGTCTCTACAGTACTTTTTTTGCTTTTCCAATAAAAATCATAATCACAGCCATAGTCAC
AAAACTATAAGATGAAAGTACAAATGATAGAAAGGATTTTTCTGATCCAGTTGTGTTTGC
TTACCGTTGTATTAGCAAGTAGTAGAGCAGTGGTTGAATTCGAAAGTACCGGAACCAAAC
TGGTCAACTCATTAAGGGTCTTGGCTGCTTACTCGCAGAGTTCTGTCTGTGTTGATGAAA
AAATATCTGGAATCGAGAGACAAATAGAGGAAGTTAAAGATATGTATGGTAACCACTCTT
TTATTCTAAAGGGTTTAAATGGTATATTGAATAACAAGGTGAATATGCTAACAAGGGAAA
TCCAAATGGAAACTGTTGGCATTAACACATTTGNAAAAGAAACAGGGACGCTANCTTAGG
GGCGNAACAGAGGGGTGNNTAGANNTTCCGTTTATGTTNATAAAAAAANANNAGANNGAN
TCGGCAAAGGAGANNTGAAATNCGCGTGATTAAGATGAAAAAGAATCCAANCCCCACTTC
GNCNGGTGGGGGNNGGGGGGGGGGGGGGGGGGGGTNNTTTTTTTTNANTTAATATNAAAN
TANCNAGAGCACNCGAGAACGNNGGGGTTGCGATGGTGGAANGNAGNCGTNAAANTGCNN
NGACAAAAGCGNCNAAGCCGCNGGCGGNATNTGAGAGACNNTGAAGANTNNAGANNNCTT
ACATNTTGGGGNAGGGTGGTTAANGTGGNGAGGANAANNGNNAGNNAAGNGATTGTGTAG
NATNCANAAANGNNNAGNCGNGGNNANGGATANCGCCNNANCGTTTNGGGAGGNGNCGGN
ATCGTNTNGNTGTNNNAAGACNAA
Quality >S03036-01_K12.phd
7 6 5 4 2 4 4 4 2 5 12 6 3 3 3 5 7
15 5 5 7 5 9 3 8 6 7 8 13 17 11 21 25 13
25 31 14 17 35 20 13 20 9 16 17 31 28 27 26 31 28
30 29 9 25 49 29 25 18 20 28 38 34 26 32 30 42 42
19 35 21 36 31 40 38 43 46 40 40 40 43 42 32 31 26
31 46 42 46 30 9 27 32 25 22 26 26 29 29 34 33 33
31 26 26 23 19 35 14 20 33 38 27 35 32 39 36 32 27
42 28 27 36 39 49 44 32 43 35 32 33 44 44 49 44 46
46 50 54 43 50 42 54 49 49 49 42 43 53 59 54 54 54
51 51 44 31 49 49 50 46 49 46 44 50 46 50 44 44 43
47 53 49 53 52 51 53 49 50 44 46 44 43 50 54 54 49
53 47 45 51 50 51 51 49 53 57 53 53 53 51 53 53 54
39 49 50 43 39 39 39 50 39 39 42 43 42 33 32 42 42
18 39 42 39 46 43 34 44 39 42 36 39 27 32 26 19 29
22 27 39 44 44 39 42 39 42 44 46 50 49 51 44 42 42
44 50 35 44 54 52 46 43 44 50 46 45 45 49 45 50 44
54 49 50 54 54 44 57 54 50 49 49 49 51 43 54 54 49
42 49 46 44 46 44 38 54 51 44 35 46 46 43 46 35 42
46 47 46 43 43 43 32 46 49 49 43 51 44 57 30 44 53
47 42 51 31 50 35 46 34 29 32 42 35 27 35 23 23 32
36 22 28 36 35 22 30 33 20 16 29 29 21 20 18 33 27
22 16 22 21 15 18 18 22 27 22 21 22 21 39 53 53 22
49 29 13 36 42 42 42 24 35 27 47 27 47 35 22 24 38
32 22 35 39 25 15 20 42 31 42 44 60 24 44 35 39 39
39 35 42 33 28 35 40 41 19 13 19 25 28 34 34 16 14
10 24 47 22 20 24 25 28 24 47 34 42 35 35 32 10 9
11 41 39 41 41 35 22 28 29 20 8 7 10 22 8 10 13
30 14 13 29 17 11 17 9 18 9 10 27 17 11 7 18 18
10 12 24 34 16 11 13 8 7 13 9 11 11 19 10 9 10
12 13 9 9 6 6 13 11 9 11 6 6 10 9 11 19 9
27 25 9 10 8 10 16 9 6 11 32 11 11 33 28 27 25
14 6 11 6 6 9 12 24 6 6 12 10 6 12 11 9 11
17 9 11 12 11 10 13 9 11 6 6 11 11 19 15 11 11
6 11 9 11 10 10 14 27 9 14 23 9 11 11 10 9 14
10 10 11 9 9 11 14 9 8 13 12 14 6 11 8 9 8
11 11 10 8 16 9 6 11 6 10 15 11 10 11 16 11 9
6 6 16 15 10 10 9 9 11 9 10 14 18 31 19 23 13
24 14 19 12 19 8 6 6 10 24 14 8 9 10 14 9 7
11 6 8 10 8 8 10 11 11 6 10 10 9 6 11 9 6
13 6 9 8 11 9 10 11 9 7 11 13 10 10 10 9 8
9 6 6 13 11 11 10 9 14 9 9 11 10 9 10 14 10
9 11 8 9 7 9 6 10 9 6 11 8 11 6 8 14 9
6 9 9 11 6 6 6 8 9 10 8 9 11 11 9 9 9
6 10 6 10 9 8 11 10 9 9 7 10 14 10 9 9 6
11 11 5 9 9 11 12 10 9 11 11 6 6 9 14 11 9
8 11 6 10 7 5 9 11 9 6 6 6 9 13 14 10 8
10 9 6 10 9 11 10 10 8 6 9 10 9 14 11 11 9
11 10 8 9 6 14 10 10 10 6 9 11 10 10 14 7 10
9 6 6 11 6 6 10 8 6 6 11 11 8 7 9 9 8
9 9 10 8 9 10 10 6 9 8 7 8 10 6 8 14 14
7 9 6 7 6 9 11 7 10 9 6 9 9 6 6 10 6
8 10 9 14 8 6 11 9 8 9 5 6 8 6 10 9 9
9 11 5 8 10 8 8 10 9 6 14 6 11 9 8 6 9
10 11 11 8 6 14 7 10 6 10 9 11 6 6 6 18 8
9 10 9 6 16 14